Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625371_at:

>probe:Drosophila_2:1625371_at:41:653; Interrogation_Position=113; Antisense; TCAACCACTTTGACGGACATCATCT
>probe:Drosophila_2:1625371_at:162:559; Interrogation_Position=127; Antisense; GGACATCATCTGAGCCACTTGGATT
>probe:Drosophila_2:1625371_at:323:259; Interrogation_Position=142; Antisense; CACTTGGATTCTCTGCATGCTCTGC
>probe:Drosophila_2:1625371_at:336:53; Interrogation_Position=158; Antisense; ATGCTCTGCCGCACCACTTGGATTA
>probe:Drosophila_2:1625371_at:690:9; Interrogation_Position=179; Antisense; ATTACGCGGTGCAGGAATCGGTCCT
>probe:Drosophila_2:1625371_at:581:127; Interrogation_Position=258; Antisense; ACCACAACCTGTATTTGCTCCAGCG
>probe:Drosophila_2:1625371_at:679:705; Interrogation_Position=289; Antisense; TTACCTGCTCTTGCACCATTTTTAC
>probe:Drosophila_2:1625371_at:572:691; Interrogation_Position=34; Antisense; TTTGCATTGGCTTTCCTGCTGGTGG
>probe:Drosophila_2:1625371_at:216:63; Interrogation_Position=425; Antisense; ATGTGCCCAGTGTCACCCATCAAGT
>probe:Drosophila_2:1625371_at:76:673; Interrogation_Position=490; Antisense; TACCGTGCCATTCCCGGACCGAAGA
>probe:Drosophila_2:1625371_at:251:533; Interrogation_Position=57; Antisense; GGGTGGTGAGGCAAAGCCCTCTCAT
>probe:Drosophila_2:1625371_at:19:41; Interrogation_Position=578; Antisense; ATCTGAAAGCCCTGCCCCTGAAGTT
>probe:Drosophila_2:1625371_at:260:615; Interrogation_Position=596; Antisense; TGAAGTTCGCTCATCACCATCACCA
>probe:Drosophila_2:1625371_at:183:279; Interrogation_Position=77; Antisense; CTCATCTTCACTACAATCACTTCGA

Paste this into a BLAST search page for me
TCAACCACTTTGACGGACATCATCTGGACATCATCTGAGCCACTTGGATTCACTTGGATTCTCTGCATGCTCTGCATGCTCTGCCGCACCACTTGGATTAATTACGCGGTGCAGGAATCGGTCCTACCACAACCTGTATTTGCTCCAGCGTTACCTGCTCTTGCACCATTTTTACTTTGCATTGGCTTTCCTGCTGGTGGATGTGCCCAGTGTCACCCATCAAGTTACCGTGCCATTCCCGGACCGAAGAGGGTGGTGAGGCAAAGCCCTCTCATATCTGAAAGCCCTGCCCCTGAAGTTTGAAGTTCGCTCATCACCATCACCACTCATCTTCACTACAATCACTTCGA

Full Affymetrix probeset data:

Annotations for 1625371_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime