FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625372_at:

>probe:Drosophila_2:1625372_at:664:545; Interrogation_Position=1011; Antisense; GGATCCCAATTTTGCCATGTTGACC
>probe:Drosophila_2:1625372_at:692:215; Interrogation_Position=1075; Antisense; AAGTTGCGTTTCACATGCGGCGGGT
>probe:Drosophila_2:1625372_at:105:623; Interrogation_Position=1090; Antisense; TGCGGCGGGTTATTTGACATCAATT
>probe:Drosophila_2:1625372_at:76:483; Interrogation_Position=1129; Antisense; GGGTTGCTTGTCACCATTTTTGGAT
>probe:Drosophila_2:1625372_at:613:619; Interrogation_Position=692; Antisense; TGCTTCAAGCTCTATGTGTGGCTCT
>probe:Drosophila_2:1625372_at:23:297; Interrogation_Position=785; Antisense; CGACAATGTTGCTGCTGTTCCTCTA
>probe:Drosophila_2:1625372_at:249:603; Interrogation_Position=800; Antisense; TGTTCCTCTACAATGGTCTGACCAT
>probe:Drosophila_2:1625372_at:102:49; Interrogation_Position=823; Antisense; ATCCTTCACATGGTCAACTGGGCGT
>probe:Drosophila_2:1625372_at:148:653; Interrogation_Position=851; Antisense; TCAACAAGTTCCTCTACGATTCGTG
>probe:Drosophila_2:1625372_at:572:613; Interrogation_Position=885; Antisense; TGAACGGTTCTTAGTTTGCTCCACG
>probe:Drosophila_2:1625372_at:401:615; Interrogation_Position=911; Antisense; TGCTTGTAAACCTTCTATTGCCTTG
>probe:Drosophila_2:1625372_at:367:691; Interrogation_Position=926; Antisense; TATTGCCTTGCCTTCTAAGTCAGCG
>probe:Drosophila_2:1625372_at:416:233; Interrogation_Position=958; Antisense; AATGCGTACAACTGCTTTCCACGAA
>probe:Drosophila_2:1625372_at:647:31; Interrogation_Position=989; Antisense; ATAAGATTCGCTGCACATCCGCGGA

Paste this into a BLAST search page for me
GGATCCCAATTTTGCCATGTTGACCAAGTTGCGTTTCACATGCGGCGGGTTGCGGCGGGTTATTTGACATCAATTGGGTTGCTTGTCACCATTTTTGGATTGCTTCAAGCTCTATGTGTGGCTCTCGACAATGTTGCTGCTGTTCCTCTATGTTCCTCTACAATGGTCTGACCATATCCTTCACATGGTCAACTGGGCGTTCAACAAGTTCCTCTACGATTCGTGTGAACGGTTCTTAGTTTGCTCCACGTGCTTGTAAACCTTCTATTGCCTTGTATTGCCTTGCCTTCTAAGTCAGCGAATGCGTACAACTGCTTTCCACGAAATAAGATTCGCTGCACATCCGCGGA

Full Affymetrix probeset data:

Annotations for 1625372_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720