Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625373_at:

>probe:Drosophila_2:1625373_at:305:679; Interrogation_Position=2209; Antisense; TATGGACGAGATCGTTACTAACGAC
>probe:Drosophila_2:1625373_at:707:707; Interrogation_Position=2223; Antisense; TTACTAACGACTGGAAACTGATTTG
>probe:Drosophila_2:1625373_at:229:325; Interrogation_Position=2260; Antisense; GCGAAGTGCCTGAATCGACGGATCA
>probe:Drosophila_2:1625373_at:141:557; Interrogation_Position=2285; Antisense; GGACGATAACTACTACAACTGACAA
>probe:Drosophila_2:1625373_at:526:567; Interrogation_Position=2344; Antisense; GGCAGACAACCGAAGCAACGCGATG
>probe:Drosophila_2:1625373_at:110:335; Interrogation_Position=2392; Antisense; GCTGTCTTTGAATTTTGCTTGCGAA
>probe:Drosophila_2:1625373_at:465:63; Interrogation_Position=2439; Antisense; ATGTGTTCTTGCTACAACATTTTGT
>probe:Drosophila_2:1625373_at:183:147; Interrogation_Position=2500; Antisense; ACTATATGACCAAAAGCCTGGGCGT
>probe:Drosophila_2:1625373_at:165:317; Interrogation_Position=2515; Antisense; GCCTGGGCGTGATTGAGCAGCTTAA
>probe:Drosophila_2:1625373_at:146:245; Interrogation_Position=2544; Antisense; AATTATCCTGGCATCAAGCCGACTC
>probe:Drosophila_2:1625373_at:378:249; Interrogation_Position=2582; Antisense; CAATCACGCCCAAGCCACGGAAAAT
>probe:Drosophila_2:1625373_at:262:15; Interrogation_Position=2645; Antisense; ATTATTACCGGCCACCATACACAAC
>probe:Drosophila_2:1625373_at:405:261; Interrogation_Position=2657; Antisense; CACCATACACAACTCACGACTTAGT
>probe:Drosophila_2:1625373_at:315:295; Interrogation_Position=2673; Antisense; CGACTTAGTGATGCGTTTGTTTATA

Paste this into a BLAST search page for me
TATGGACGAGATCGTTACTAACGACTTACTAACGACTGGAAACTGATTTGGCGAAGTGCCTGAATCGACGGATCAGGACGATAACTACTACAACTGACAAGGCAGACAACCGAAGCAACGCGATGGCTGTCTTTGAATTTTGCTTGCGAAATGTGTTCTTGCTACAACATTTTGTACTATATGACCAAAAGCCTGGGCGTGCCTGGGCGTGATTGAGCAGCTTAAAATTATCCTGGCATCAAGCCGACTCCAATCACGCCCAAGCCACGGAAAATATTATTACCGGCCACCATACACAACCACCATACACAACTCACGACTTAGTCGACTTAGTGATGCGTTTGTTTATA

Full Affymetrix probeset data:

Annotations for 1625373_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime