Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625374_at:

>probe:Drosophila_2:1625374_at:223:463; Interrogation_Position=2504; Antisense; GATTGCCCGTGGTAAGGTGTTCCTA
>probe:Drosophila_2:1625374_at:593:601; Interrogation_Position=2521; Antisense; TGTTCCTAATCCTTAACGCCGCCGA
>probe:Drosophila_2:1625374_at:333:633; Interrogation_Position=2556; Antisense; TCCGCCGAGCGCGAAGCCGAAAAGG
>probe:Drosophila_2:1625374_at:537:387; Interrogation_Position=2574; Antisense; GAAAAGGAGTTCCATCTGCCCCTTT
>probe:Drosophila_2:1625374_at:206:39; Interrogation_Position=2587; Antisense; ATCTGCCCCTTTGGAAGTTCTTCAG
>probe:Drosophila_2:1625374_at:349:551; Interrogation_Position=2732; Antisense; GGAGAACTTCAAGGATCACATCGAA
>probe:Drosophila_2:1625374_at:450:383; Interrogation_Position=2801; Antisense; GAACGGAGTCGAAATCCGCGAAACT
>probe:Drosophila_2:1625374_at:120:303; Interrogation_Position=2816; Antisense; CCGCGAAACTACCTTGGATGGCAAC
>probe:Drosophila_2:1625374_at:562:583; Interrogation_Position=2834; Antisense; TGGCAACCTGCCCTTGAGTGACATG
>probe:Drosophila_2:1625374_at:414:115; Interrogation_Position=2860; Antisense; AGCAGTTCAAGTTCCACGCTGAGGG
>probe:Drosophila_2:1625374_at:582:649; Interrogation_Position=2901; Antisense; TCAGAACCTGAGTACTACACCTCGT
>probe:Drosophila_2:1625374_at:14:333; Interrogation_Position=2936; Antisense; GCTGTCCGCTAACCAGACGCAAGAT
>probe:Drosophila_2:1625374_at:259:129; Interrogation_Position=2947; Antisense; ACCAGACGCAAGATGCCGCCGAGTT
>probe:Drosophila_2:1625374_at:314:429; Interrogation_Position=2967; Antisense; GAGTTCGCTGTCACATTGTATCCAA

Paste this into a BLAST search page for me
GATTGCCCGTGGTAAGGTGTTCCTATGTTCCTAATCCTTAACGCCGCCGATCCGCCGAGCGCGAAGCCGAAAAGGGAAAAGGAGTTCCATCTGCCCCTTTATCTGCCCCTTTGGAAGTTCTTCAGGGAGAACTTCAAGGATCACATCGAAGAACGGAGTCGAAATCCGCGAAACTCCGCGAAACTACCTTGGATGGCAACTGGCAACCTGCCCTTGAGTGACATGAGCAGTTCAAGTTCCACGCTGAGGGTCAGAACCTGAGTACTACACCTCGTGCTGTCCGCTAACCAGACGCAAGATACCAGACGCAAGATGCCGCCGAGTTGAGTTCGCTGTCACATTGTATCCAA

Full Affymetrix probeset data:

Annotations for 1625374_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime