Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625375_at:

>probe:Drosophila_2:1625375_at:616:65; Interrogation_Position=1057; Antisense; ATGGTTAATGGCTACGCCAGCCAGA
>probe:Drosophila_2:1625375_at:327:241; Interrogation_Position=1132; Antisense; AATACTTCATTGGTTCGGGAGCGCA
>probe:Drosophila_2:1625375_at:141:717; Interrogation_Position=1145; Antisense; TTCGGGAGCGCATCAATCAGCGGAT
>probe:Drosophila_2:1625375_at:78:67; Interrogation_Position=1226; Antisense; ATGGATTGGGCACCTATTTCCAACC
>probe:Drosophila_2:1625375_at:181:717; Interrogation_Position=1256; Antisense; TTGACTACTCGTCCGATGGTTTTGA
>probe:Drosophila_2:1625375_at:89:95; Interrogation_Position=1341; Antisense; AGTTCCACAAGGAGGTGCCACTGTT
>probe:Drosophila_2:1625375_at:521:435; Interrogation_Position=1352; Antisense; GAGGTGCCACTGTTTTTCCGGAAAT
>probe:Drosophila_2:1625375_at:119:599; Interrogation_Position=1382; Antisense; TTACGGTCTTCCCACAAAAAGGCAG
>probe:Drosophila_2:1625375_at:172:227; Interrogation_Position=1400; Antisense; AAGGCAGCATGTTGTACTGGTTCAA
>probe:Drosophila_2:1625375_at:625:271; Interrogation_Position=1449; Antisense; CATAAGAAGCCTACACTCGGTGTGT
>probe:Drosophila_2:1625375_at:65:375; Interrogation_Position=1544; Antisense; GAAGTTTTCTTTTACAGCGCTCACA
>probe:Drosophila_2:1625375_at:26:257; Interrogation_Position=1567; Antisense; CAAAGTGGGTTCCTATGTTTCCGCA
>probe:Drosophila_2:1625375_at:315:479; Interrogation_Position=1583; Antisense; GTTTCCGCAAATGTTTAGCTTCCCA
>probe:Drosophila_2:1625375_at:621:673; Interrogation_Position=1598; Antisense; TAGCTTCCCATGCAAATCGTAGTAA

Paste this into a BLAST search page for me
ATGGTTAATGGCTACGCCAGCCAGAAATACTTCATTGGTTCGGGAGCGCATTCGGGAGCGCATCAATCAGCGGATATGGATTGGGCACCTATTTCCAACCTTGACTACTCGTCCGATGGTTTTGAAGTTCCACAAGGAGGTGCCACTGTTGAGGTGCCACTGTTTTTCCGGAAATTTACGGTCTTCCCACAAAAAGGCAGAAGGCAGCATGTTGTACTGGTTCAACATAAGAAGCCTACACTCGGTGTGTGAAGTTTTCTTTTACAGCGCTCACACAAAGTGGGTTCCTATGTTTCCGCAGTTTCCGCAAATGTTTAGCTTCCCATAGCTTCCCATGCAAATCGTAGTAA

Full Affymetrix probeset data:

Annotations for 1625375_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime