Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625377_at:

>probe:Drosophila_2:1625377_at:333:677; Interrogation_Position=1015; Antisense; TAGTTTCTTCTCTTTTTGCGGCGAC
>probe:Drosophila_2:1625377_at:34:723; Interrogation_Position=1030; Antisense; TTGCGGCGACAATTTACCTAGAAAA
>probe:Drosophila_2:1625377_at:288:291; Interrogation_Position=530; Antisense; CGGGACTCACGCTTATATTCATTAT
>probe:Drosophila_2:1625377_at:5:37; Interrogation_Position=553; Antisense; ATCATACAATCTCTGGCCATGACCT
>probe:Drosophila_2:1625377_at:187:57; Interrogation_Position=571; Antisense; ATGACCTGGTACTCGCTGTCGTACA
>probe:Drosophila_2:1625377_at:413:269; Interrogation_Position=627; Antisense; CATGTCGGCAATTCTGGAGGTCTAG
>probe:Drosophila_2:1625377_at:125:549; Interrogation_Position=642; Antisense; GGAGGTCTAGAATCAGATGCGCTTC
>probe:Drosophila_2:1625377_at:146:447; Interrogation_Position=657; Antisense; GATGCGCTTCTGTACATAGCTCGAG
>probe:Drosophila_2:1625377_at:456:313; Interrogation_Position=686; Antisense; GCCAGATTGGTTTGTAGCTTAAGCT
>probe:Drosophila_2:1625377_at:588:601; Interrogation_Position=728; Antisense; TGTATTGTATTAACCTAGCACTAGA
>probe:Drosophila_2:1625377_at:74:371; Interrogation_Position=758; Antisense; GAATGTCCTTTATATTCTCTTATTA
>probe:Drosophila_2:1625377_at:122:271; Interrogation_Position=918; Antisense; CATAATTCTCTTCTCTGTTTTGGTT
>probe:Drosophila_2:1625377_at:138:171; Interrogation_Position=951; Antisense; AAAGAATGGCCCGATCCACTTTGTT
>probe:Drosophila_2:1625377_at:186:49; Interrogation_Position=964; Antisense; ATCCACTTTGTTTCTGCAGCTTTAA

Paste this into a BLAST search page for me
TAGTTTCTTCTCTTTTTGCGGCGACTTGCGGCGACAATTTACCTAGAAAACGGGACTCACGCTTATATTCATTATATCATACAATCTCTGGCCATGACCTATGACCTGGTACTCGCTGTCGTACACATGTCGGCAATTCTGGAGGTCTAGGGAGGTCTAGAATCAGATGCGCTTCGATGCGCTTCTGTACATAGCTCGAGGCCAGATTGGTTTGTAGCTTAAGCTTGTATTGTATTAACCTAGCACTAGAGAATGTCCTTTATATTCTCTTATTACATAATTCTCTTCTCTGTTTTGGTTAAAGAATGGCCCGATCCACTTTGTTATCCACTTTGTTTCTGCAGCTTTAA

Full Affymetrix probeset data:

Annotations for 1625377_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime