FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625380_at:

>probe:Drosophila_2:1625380_at:308:725; Interrogation_Position=118; Antisense; TTGGTTCCACGTCGCAGAATTGGTT
>probe:Drosophila_2:1625380_at:25:363; Interrogation_Position=134; Antisense; GAATTGGTTTTATTGCCGCCAGATA
>probe:Drosophila_2:1625380_at:182:309; Interrogation_Position=183; Antisense; CCAGGCAGTGGAGTTTGTTCGCAGC
>probe:Drosophila_2:1625380_at:515:327; Interrogation_Position=206; Antisense; GCGATGAGTTCATAGCCACTTGGCA
>probe:Drosophila_2:1625380_at:59:507; Interrogation_Position=239; Antisense; GTGCCACTCCGGATTTCGTGAATAT
>probe:Drosophila_2:1625380_at:90:463; Interrogation_Position=280; Antisense; GATTACGGTTCTGGCTACGACATTA
>probe:Drosophila_2:1625380_at:710:591; Interrogation_Position=311; Antisense; TGGTGGACAGCTTGCCAACACGTTT
>probe:Drosophila_2:1625380_at:368:157; Interrogation_Position=328; Antisense; ACACGTTTGCGTGCCTATCAACTGT
>probe:Drosophila_2:1625380_at:246:193; Interrogation_Position=347; Antisense; AACTGTCGCGGACTGTACCAGTGGA
>probe:Drosophila_2:1625380_at:603:83; Interrogation_Position=366; Antisense; AGTGGAACTGATGCTGCGACGCGAC
>probe:Drosophila_2:1625380_at:366:383; Interrogation_Position=393; Antisense; GAACACCTTCCTCTGGGATGTTATT
>probe:Drosophila_2:1625380_at:495:475; Interrogation_Position=412; Antisense; GTTATTCATAGTTTACCCAGGACCA
>probe:Drosophila_2:1625380_at:156:259; Interrogation_Position=474; Antisense; CACTGAATTCGCCAAACTCTACAAG
>probe:Drosophila_2:1625380_at:92:507; Interrogation_Position=536; Antisense; GTGCCAGACTTTCCAGAGATCTTCA

Paste this into a BLAST search page for me
TTGGTTCCACGTCGCAGAATTGGTTGAATTGGTTTTATTGCCGCCAGATACCAGGCAGTGGAGTTTGTTCGCAGCGCGATGAGTTCATAGCCACTTGGCAGTGCCACTCCGGATTTCGTGAATATGATTACGGTTCTGGCTACGACATTATGGTGGACAGCTTGCCAACACGTTTACACGTTTGCGTGCCTATCAACTGTAACTGTCGCGGACTGTACCAGTGGAAGTGGAACTGATGCTGCGACGCGACGAACACCTTCCTCTGGGATGTTATTGTTATTCATAGTTTACCCAGGACCACACTGAATTCGCCAAACTCTACAAGGTGCCAGACTTTCCAGAGATCTTCA

Full Affymetrix probeset data:

Annotations for 1625380_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720