Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625381_at:

>probe:Drosophila_2:1625381_at:187:275; Interrogation_Position=106; Antisense; CTTGTGGTCTTGGTGGCTGGACAAA
>probe:Drosophila_2:1625381_at:707:381; Interrogation_Position=135; Antisense; GAACTGCGACGAGTTGACCCGGAGA
>probe:Drosophila_2:1625381_at:242:609; Interrogation_Position=149; Antisense; TGACCCGGAGATGTGAACGCTGTGT
>probe:Drosophila_2:1625381_at:343:233; Interrogation_Position=187; Antisense; AATGCAGCTGATCGTAACCTGCCCG
>probe:Drosophila_2:1625381_at:551:625; Interrogation_Position=206; Antisense; TGCCCGTCCTCAATCAAGAGTGCAG
>probe:Drosophila_2:1625381_at:661:211; Interrogation_Position=235; Antisense; AAGACTCGGAACAATTGGCGTTGGA
>probe:Drosophila_2:1625381_at:709:453; Interrogation_Position=25; Antisense; GATAAGTTCCAGTCAACAGCCAAAA
>probe:Drosophila_2:1625381_at:118:61; Interrogation_Position=263; Antisense; ATGTAGGACGTTGTGAGCTGACCAG
>probe:Drosophila_2:1625381_at:456:285; Interrogation_Position=280; Antisense; CTGACCAGGCTGAACTGCTTGGGTT
>probe:Drosophila_2:1625381_at:527:343; Interrogation_Position=296; Antisense; GCTTGGGTTCTAATCGACGCATGAA
>probe:Drosophila_2:1625381_at:610:231; Interrogation_Position=325; Antisense; AATGATATTGCTGAACTCGCTGGCA
>probe:Drosophila_2:1625381_at:369:383; Interrogation_Position=337; Antisense; GAACTCGCTGGCATGGATCGTATTA
>probe:Drosophila_2:1625381_at:695:665; Interrogation_Position=75; Antisense; TACAGCAGTTGTGACCCTATTTTCT
>probe:Drosophila_2:1625381_at:604:277; Interrogation_Position=91; Antisense; CTATTTTCTGTCCTGCTTGTGGTCT

Paste this into a BLAST search page for me
CTTGTGGTCTTGGTGGCTGGACAAAGAACTGCGACGAGTTGACCCGGAGATGACCCGGAGATGTGAACGCTGTGTAATGCAGCTGATCGTAACCTGCCCGTGCCCGTCCTCAATCAAGAGTGCAGAAGACTCGGAACAATTGGCGTTGGAGATAAGTTCCAGTCAACAGCCAAAAATGTAGGACGTTGTGAGCTGACCAGCTGACCAGGCTGAACTGCTTGGGTTGCTTGGGTTCTAATCGACGCATGAAAATGATATTGCTGAACTCGCTGGCAGAACTCGCTGGCATGGATCGTATTATACAGCAGTTGTGACCCTATTTTCTCTATTTTCTGTCCTGCTTGTGGTCT

Full Affymetrix probeset data:

Annotations for 1625381_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime