FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625382_at:

>probe:Drosophila_2:1625382_at:125:71; Interrogation_Position=1224; Antisense; AGGAATCTTTACTACTTTCCGCACT
>probe:Drosophila_2:1625382_at:8:651; Interrogation_Position=1251; Antisense; TCACTCTTCACGCTGTATCTCAATT
>probe:Drosophila_2:1625382_at:419:483; Interrogation_Position=1265; Antisense; GTATCTCAATTTCATGGCTGCACCT
>probe:Drosophila_2:1625382_at:350:571; Interrogation_Position=1280; Antisense; GGCTGCACCTTTGATAAATGGACTG
>probe:Drosophila_2:1625382_at:437:87; Interrogation_Position=1320; Antisense; AGTCGATCCATCAGTCAAAGCCAGT
>probe:Drosophila_2:1625382_at:17:281; Interrogation_Position=1357; Antisense; CTAACTGTATCTATCTCTCATCTGT
>probe:Drosophila_2:1625382_at:550:647; Interrogation_Position=1374; Antisense; TCATCTGTTTCCATCTATCTCTGTT
>probe:Drosophila_2:1625382_at:571:683; Interrogation_Position=1389; Antisense; TATCTCTGTTCTACGACTATCTCTA
>probe:Drosophila_2:1625382_at:79:39; Interrogation_Position=1407; Antisense; ATCTCTATCTGTACCTCTACCTTAA
>probe:Drosophila_2:1625382_at:76:131; Interrogation_Position=1425; Antisense; ACCTTAATCTATCTACCTATCTGTC
>probe:Drosophila_2:1625382_at:153:279; Interrogation_Position=1441; Antisense; CTATCTGTCTATCCATATCTGTCTG
>probe:Drosophila_2:1625382_at:18:405; Interrogation_Position=1465; Antisense; GACTATCTGGACTTTCTCACTTTAC
>probe:Drosophila_2:1625382_at:435:527; Interrogation_Position=1495; Antisense; GGGAAAGACCAACCGAATGCTGCTA
>probe:Drosophila_2:1625382_at:491:347; Interrogation_Position=963; Antisense; GCAGGCCCGCCGGTAAACAATTGGT

Paste this into a BLAST search page for me
AGGAATCTTTACTACTTTCCGCACTTCACTCTTCACGCTGTATCTCAATTGTATCTCAATTTCATGGCTGCACCTGGCTGCACCTTTGATAAATGGACTGAGTCGATCCATCAGTCAAAGCCAGTCTAACTGTATCTATCTCTCATCTGTTCATCTGTTTCCATCTATCTCTGTTTATCTCTGTTCTACGACTATCTCTAATCTCTATCTGTACCTCTACCTTAAACCTTAATCTATCTACCTATCTGTCCTATCTGTCTATCCATATCTGTCTGGACTATCTGGACTTTCTCACTTTACGGGAAAGACCAACCGAATGCTGCTAGCAGGCCCGCCGGTAAACAATTGGT

Full Affymetrix probeset data:

Annotations for 1625382_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720