FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625383_at:

>probe:Drosophila_2:1625383_at:218:51; Interrogation_Position=13; Antisense; ATGCTGCAAATCTCTCGACGTCTAA
>probe:Drosophila_2:1625383_at:426:181; Interrogation_Position=177; Antisense; AAAAGCGGGCTTACGAAATCACGAG
>probe:Drosophila_2:1625383_at:381:693; Interrogation_Position=205; Antisense; TTTGAATTGAATGAGCCACGCAGAT
>probe:Drosophila_2:1625383_at:334:259; Interrogation_Position=221; Antisense; CACGCAGATCGTGGGCTTCTCAGGG
>probe:Drosophila_2:1625383_at:251:475; Interrogation_Position=264; Antisense; GTTACAAGTCACAAGCACTCTCACA
>probe:Drosophila_2:1625383_at:418:407; Interrogation_Position=29; Antisense; GACGTCTAACTGCAGCCAAAGTCGC
>probe:Drosophila_2:1625383_at:313:577; Interrogation_Position=328; Antisense; GGCGCTTACAAAATTCACACAGTGT
>probe:Drosophila_2:1625383_at:415:7; Interrogation_Position=357; Antisense; ATTGCACTTCACAAGGGAACCTCTG
>probe:Drosophila_2:1625383_at:596:551; Interrogation_Position=390; Antisense; GGAGCACATCTCTTGATCGTTACAA
>probe:Drosophila_2:1625383_at:54:441; Interrogation_Position=441; Antisense; GATGGAATGCTAGTCGAACACCGAT
>probe:Drosophila_2:1625383_at:274:165; Interrogation_Position=46; Antisense; AAAGTCGCACTTGCAGTCGTCTCTC
>probe:Drosophila_2:1625383_at:524:33; Interrogation_Position=510; Antisense; ATCAACGGCATCAACGGCATCATCA
>probe:Drosophila_2:1625383_at:154:151; Interrogation_Position=538; Antisense; ACATCAACATCGTCAGCAGCGGATA
>probe:Drosophila_2:1625383_at:623:635; Interrogation_Position=78; Antisense; TCGAATCTCGAATCCGCTGCAGCAG

Paste this into a BLAST search page for me
ATGCTGCAAATCTCTCGACGTCTAAAAAAGCGGGCTTACGAAATCACGAGTTTGAATTGAATGAGCCACGCAGATCACGCAGATCGTGGGCTTCTCAGGGGTTACAAGTCACAAGCACTCTCACAGACGTCTAACTGCAGCCAAAGTCGCGGCGCTTACAAAATTCACACAGTGTATTGCACTTCACAAGGGAACCTCTGGGAGCACATCTCTTGATCGTTACAAGATGGAATGCTAGTCGAACACCGATAAAGTCGCACTTGCAGTCGTCTCTCATCAACGGCATCAACGGCATCATCAACATCAACATCGTCAGCAGCGGATATCGAATCTCGAATCCGCTGCAGCAG

Full Affymetrix probeset data:

Annotations for 1625383_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720