FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625385_at:

>probe:Drosophila_2:1625385_at:215:175; Interrogation_Position=1978; Antisense; AAACCAGTACGCACAATTGAGAAAA
>probe:Drosophila_2:1625385_at:564:257; Interrogation_Position=2044; Antisense; CACTCGGCCACTTTTCTTGTAATTT
>probe:Drosophila_2:1625385_at:164:59; Interrogation_Position=2087; Antisense; ATGTTGCCCGAGTACGACGAAACCG
>probe:Drosophila_2:1625385_at:29:227; Interrogation_Position=2161; Antisense; AATGAGCGGCGGGACTTTTGACTTC
>probe:Drosophila_2:1625385_at:299:611; Interrogation_Position=2179; Antisense; TGACTTCTTCTTTACACGCCCAAGA
>probe:Drosophila_2:1625385_at:389:179; Interrogation_Position=2253; Antisense; AAAAACTAACATACAGCCAGGGATT
>probe:Drosophila_2:1625385_at:246:157; Interrogation_Position=2265; Antisense; ACAGCCAGGGATTTCGAGCCTTTTC
>probe:Drosophila_2:1625385_at:432:415; Interrogation_Position=2280; Antisense; GAGCCTTTTCCCTGGGACAGCAATT
>probe:Drosophila_2:1625385_at:76:559; Interrogation_Position=2294; Antisense; GGACAGCAATTTCAACCCAACATCA
>probe:Drosophila_2:1625385_at:34:245; Interrogation_Position=2301; Antisense; AATTTCAACCCAACATCAAGCCAAG
>probe:Drosophila_2:1625385_at:316:397; Interrogation_Position=2427; Antisense; GACAAGACAATTTTTACGCCTACAA
>probe:Drosophila_2:1625385_at:316:133; Interrogation_Position=2442; Antisense; ACGCCTACAAATTTGTTGAATGCCT
>probe:Drosophila_2:1625385_at:85:369; Interrogation_Position=2459; Antisense; GAATGCCTTTGTTTACACAGTACCA
>probe:Drosophila_2:1625385_at:608:213; Interrogation_Position=2499; Antisense; AAGATGTCGCGTCAAGAAATGGGAT

Paste this into a BLAST search page for me
AAACCAGTACGCACAATTGAGAAAACACTCGGCCACTTTTCTTGTAATTTATGTTGCCCGAGTACGACGAAACCGAATGAGCGGCGGGACTTTTGACTTCTGACTTCTTCTTTACACGCCCAAGAAAAAACTAACATACAGCCAGGGATTACAGCCAGGGATTTCGAGCCTTTTCGAGCCTTTTCCCTGGGACAGCAATTGGACAGCAATTTCAACCCAACATCAAATTTCAACCCAACATCAAGCCAAGGACAAGACAATTTTTACGCCTACAAACGCCTACAAATTTGTTGAATGCCTGAATGCCTTTGTTTACACAGTACCAAAGATGTCGCGTCAAGAAATGGGAT

Full Affymetrix probeset data:

Annotations for 1625385_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720