Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625386_at:

>probe:Drosophila_2:1625386_at:726:361; Interrogation_Position=2602; Antisense; GCAATAGCATGCACCACCCAGGAAC
>probe:Drosophila_2:1625386_at:108:379; Interrogation_Position=2623; Antisense; GAACCCCTTCTGGAAATCGTCGTCG
>probe:Drosophila_2:1625386_at:73:629; Interrogation_Position=2648; Antisense; TCCCTCTCTTCCATAAAAACCGAAT
>probe:Drosophila_2:1625386_at:60:369; Interrogation_Position=2669; Antisense; GAATGTATTGAAGGCTCCGCGGCCA
>probe:Drosophila_2:1625386_at:340:633; Interrogation_Position=2684; Antisense; TCCGCGGCCAAGTACTCAGATAACT
>probe:Drosophila_2:1625386_at:471:361; Interrogation_Position=2733; Antisense; GCAATATGTTCTGGCGTTGTCGTCC
>probe:Drosophila_2:1625386_at:146:723; Interrogation_Position=2749; Antisense; TTGTCGTCCTCCCAAATTGCAACCA
>probe:Drosophila_2:1625386_at:11:723; Interrogation_Position=2765; Antisense; TTGCAACCACAACCCCTACAAAATG
>probe:Drosophila_2:1625386_at:381:491; Interrogation_Position=2789; Antisense; GTACAACACTTTTAACACACAACAA
>probe:Drosophila_2:1625386_at:234:235; Interrogation_Position=2919; Antisense; AATCCACACACAGAATTGCTCTTTT
>probe:Drosophila_2:1625386_at:295:139; Interrogation_Position=2948; Antisense; ACGATTGTATATAGCTGTTCCATTA
>probe:Drosophila_2:1625386_at:655:331; Interrogation_Position=2961; Antisense; GCTGTTCCATTACGTTTAACCTGGG
>probe:Drosophila_2:1625386_at:188:729; Interrogation_Position=3039; Antisense; TTGTGCGATATCACCGTAGCCATAT
>probe:Drosophila_2:1625386_at:188:103; Interrogation_Position=3143; Antisense; AGACTTACTTCTATATATTCCCGAG

Paste this into a BLAST search page for me
GCAATAGCATGCACCACCCAGGAACGAACCCCTTCTGGAAATCGTCGTCGTCCCTCTCTTCCATAAAAACCGAATGAATGTATTGAAGGCTCCGCGGCCATCCGCGGCCAAGTACTCAGATAACTGCAATATGTTCTGGCGTTGTCGTCCTTGTCGTCCTCCCAAATTGCAACCATTGCAACCACAACCCCTACAAAATGGTACAACACTTTTAACACACAACAAAATCCACACACAGAATTGCTCTTTTACGATTGTATATAGCTGTTCCATTAGCTGTTCCATTACGTTTAACCTGGGTTGTGCGATATCACCGTAGCCATATAGACTTACTTCTATATATTCCCGAG

Full Affymetrix probeset data:

Annotations for 1625386_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime