FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625389_at:

>probe:Drosophila_2:1625389_at:134:81; Interrogation_Position=1004; Antisense; AGGTGCGCCTGCAGGATGGCTCAAC
>probe:Drosophila_2:1625389_at:61:69; Interrogation_Position=1019; Antisense; ATGGCTCAACACTACAGGAAACCTT
>probe:Drosophila_2:1625389_at:127:559; Interrogation_Position=1035; Antisense; GGAAACCTTCAACGTCAAGGAGCAG
>probe:Drosophila_2:1625389_at:244:225; Interrogation_Position=1051; Antisense; AAGGAGCAGCTGTCCGCCGTACGTG
>probe:Drosophila_2:1625389_at:720:317; Interrogation_Position=1066; Antisense; GCCGTACGTGTGTTCATCCAGATGA
>probe:Drosophila_2:1625389_at:464:43; Interrogation_Position=1087; Antisense; ATGAAGACCGGCATCGAGTCGCCCT
>probe:Drosophila_2:1625389_at:687:205; Interrogation_Position=1138; Antisense; AAGCTGTTCGCCGAGGACGACTACG
>probe:Drosophila_2:1625389_at:331:371; Interrogation_Position=1174; Antisense; GAAGTGCTCGGCTTGGTTCCATCCG
>probe:Drosophila_2:1625389_at:272:211; Interrogation_Position=1216; Antisense; AAGACGCCCGCATAAATCTTTCCTA
>probe:Drosophila_2:1625389_at:634:365; Interrogation_Position=1257; Antisense; GAATCCGGGTAATCTCTCCCATAAA
>probe:Drosophila_2:1625389_at:471:299; Interrogation_Position=833; Antisense; CCCGCGATCGGGTAAAGGCTCAAAT
>probe:Drosophila_2:1625389_at:531:559; Interrogation_Position=864; Antisense; GGACAAGGCAGCACGCAAGGCTAGA
>probe:Drosophila_2:1625389_at:535:247; Interrogation_Position=899; Antisense; AATTGGGCAACGCAGAGCCAGCTCC
>probe:Drosophila_2:1625389_at:482:533; Interrogation_Position=961; Antisense; GGTGTGAAATCTCCGCCGCGAGACT

Paste this into a BLAST search page for me
AGGTGCGCCTGCAGGATGGCTCAACATGGCTCAACACTACAGGAAACCTTGGAAACCTTCAACGTCAAGGAGCAGAAGGAGCAGCTGTCCGCCGTACGTGGCCGTACGTGTGTTCATCCAGATGAATGAAGACCGGCATCGAGTCGCCCTAAGCTGTTCGCCGAGGACGACTACGGAAGTGCTCGGCTTGGTTCCATCCGAAGACGCCCGCATAAATCTTTCCTAGAATCCGGGTAATCTCTCCCATAAACCCGCGATCGGGTAAAGGCTCAAATGGACAAGGCAGCACGCAAGGCTAGAAATTGGGCAACGCAGAGCCAGCTCCGGTGTGAAATCTCCGCCGCGAGACT

Full Affymetrix probeset data:

Annotations for 1625389_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720