FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625392_at:

>probe:Drosophila_2:1625392_at:590:115; Interrogation_Position=13; Antisense; AGCCTTTTTTGCCTAACCATTACAG
>probe:Drosophila_2:1625392_at:334:309; Interrogation_Position=140; Antisense; CCAGCTGTTCAGTTATCGGTTCATC
>probe:Drosophila_2:1625392_at:213:1; Interrogation_Position=176; Antisense; AAATGTCAGCGGCACGTTTATACGG
>probe:Drosophila_2:1625392_at:369:697; Interrogation_Position=210; Antisense; TTTATTTTCCTCGAGTGCCGTGCAG
>probe:Drosophila_2:1625392_at:163:549; Interrogation_Position=264; Antisense; GGAGGCCGTGGCAGTGACCAAAAAT
>probe:Drosophila_2:1625392_at:219:65; Interrogation_Position=287; Antisense; ATGGTCGCACCATTGTGGCCTGGCA
>probe:Drosophila_2:1625392_at:62:565; Interrogation_Position=387; Antisense; TAAGGAATCGGCTCTGAAGACGGCG
>probe:Drosophila_2:1625392_at:135:375; Interrogation_Position=402; Antisense; GAAGACGGCGATGCGTGCCTTTAAA
>probe:Drosophila_2:1625392_at:41:189; Interrogation_Position=431; Antisense; AACATCCAGAAGTGGCTCGCCAGGA
>probe:Drosophila_2:1625392_at:258:607; Interrogation_Position=458; Antisense; TGATGCAGCTGACCCACACGACTAA
>probe:Drosophila_2:1625392_at:693:369; Interrogation_Position=513; Antisense; GAAGGCCAAGCAAACGCCGATGGAC
>probe:Drosophila_2:1625392_at:546:437; Interrogation_Position=531; Antisense; GATGGACCGGCCGTACCTATAGTTT
>probe:Drosophila_2:1625392_at:432:477; Interrogation_Position=552; Antisense; GTTTTCCACCCAGTGCATTGCATAA
>probe:Drosophila_2:1625392_at:281:487; Interrogation_Position=95; Antisense; GTAGCTAATGTTGCATCACTGCCCA

Paste this into a BLAST search page for me
AGCCTTTTTTGCCTAACCATTACAGCCAGCTGTTCAGTTATCGGTTCATCAAATGTCAGCGGCACGTTTATACGGTTTATTTTCCTCGAGTGCCGTGCAGGGAGGCCGTGGCAGTGACCAAAAATATGGTCGCACCATTGTGGCCTGGCATAAGGAATCGGCTCTGAAGACGGCGGAAGACGGCGATGCGTGCCTTTAAAAACATCCAGAAGTGGCTCGCCAGGATGATGCAGCTGACCCACACGACTAAGAAGGCCAAGCAAACGCCGATGGACGATGGACCGGCCGTACCTATAGTTTGTTTTCCACCCAGTGCATTGCATAAGTAGCTAATGTTGCATCACTGCCCA

Full Affymetrix probeset data:

Annotations for 1625392_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720