Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625393_s_at:

>probe:Drosophila_2:1625393_s_at:349:331; Interrogation_Position=1004; Antisense; GCGGATGCCGCATATCAGAAGTGCA
>probe:Drosophila_2:1625393_s_at:205:221; Interrogation_Position=1022; Antisense; AAGTGCATGGAACGCTTCGCCCAAG
>probe:Drosophila_2:1625393_s_at:7:209; Interrogation_Position=1044; Antisense; AAGCAGTGCAAATCGCCCTGAGCTC
>probe:Drosophila_2:1625393_s_at:247:195; Interrogation_Position=1070; Antisense; AACTGCATCACCAATCAGATCCAGC
>probe:Drosophila_2:1625393_s_at:341:621; Interrogation_Position=1095; Antisense; TGCTGTGCCTCTTGGAATCTTTACC
>probe:Drosophila_2:1625393_s_at:699:275; Interrogation_Position=1113; Antisense; CTTTACCTCCACACAAGCTGATGAA
>probe:Drosophila_2:1625393_s_at:564:387; Interrogation_Position=1135; Antisense; GAAAATCGTCATAGAGGCGCACAAG
>probe:Drosophila_2:1625393_s_at:456:269; Interrogation_Position=798; Antisense; CAGGCCTGCTTCGATGGGTGGTCCT
>probe:Drosophila_2:1625393_s_at:611:201; Interrogation_Position=839; Antisense; AACCGTTCCGCCTATAGCAATTTGC
>probe:Drosophila_2:1625393_s_at:132:27; Interrogation_Position=852; Antisense; ATAGCAATTTGCATCTATCCCTCCT
>probe:Drosophila_2:1625393_s_at:312:623; Interrogation_Position=876; Antisense; TGCGTGCTCTGCAACAGCTTGTCAG
>probe:Drosophila_2:1625393_s_at:4:125; Interrogation_Position=916; Antisense; AGCGCTGCCCAGTCAAGATCTTATG
>probe:Drosophila_2:1625393_s_at:626:41; Interrogation_Position=944; Antisense; ATCGTGAAATCCCTGCAGAGCTACT
>probe:Drosophila_2:1625393_s_at:608:669; Interrogation_Position=965; Antisense; TACTGCGCACGGCTGGCGGAATCAA

Paste this into a BLAST search page for me
GCGGATGCCGCATATCAGAAGTGCAAAGTGCATGGAACGCTTCGCCCAAGAAGCAGTGCAAATCGCCCTGAGCTCAACTGCATCACCAATCAGATCCAGCTGCTGTGCCTCTTGGAATCTTTACCCTTTACCTCCACACAAGCTGATGAAGAAAATCGTCATAGAGGCGCACAAGCAGGCCTGCTTCGATGGGTGGTCCTAACCGTTCCGCCTATAGCAATTTGCATAGCAATTTGCATCTATCCCTCCTTGCGTGCTCTGCAACAGCTTGTCAGAGCGCTGCCCAGTCAAGATCTTATGATCGTGAAATCCCTGCAGAGCTACTTACTGCGCACGGCTGGCGGAATCAA

Full Affymetrix probeset data:

Annotations for 1625393_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime