FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625394_at:

>probe:Drosophila_2:1625394_at:13:613; Interrogation_Position=328; Antisense; TGAAACGACATGACGACGGCGCCGC
>probe:Drosophila_2:1625394_at:508:141; Interrogation_Position=343; Antisense; ACGGCGCCGCAGATTTGGAACGTGT
>probe:Drosophila_2:1625394_at:541:223; Interrogation_Position=387; Antisense; AAGGAGATCTCTGCGGACAATATAT
>probe:Drosophila_2:1625394_at:692:559; Interrogation_Position=401; Antisense; GGACAATATATCCAGCGCCGTGGAG
>probe:Drosophila_2:1625394_at:461:321; Interrogation_Position=415; Antisense; GCGCCGTGGAGCAGTTTGGCAACCA
>probe:Drosophila_2:1625394_at:247:419; Interrogation_Position=480; Antisense; GAGCTCCAGAAGGTCCAAGTCAAGA
>probe:Drosophila_2:1625394_at:238:623; Interrogation_Position=535; Antisense; TGCTGGTTAGCAAGGCGCATGCCGA
>probe:Drosophila_2:1625394_at:39:51; Interrogation_Position=553; Antisense; ATGCCGAGAAAGTGCTCCGCGAGCA
>probe:Drosophila_2:1625394_at:531:315; Interrogation_Position=597; Antisense; GCCTTGGAAGCCATCATCAGCAATT
>probe:Drosophila_2:1625394_at:65:249; Interrogation_Position=617; Antisense; CAATTGAGGTGCTCGTGGAATCCGA
>probe:Drosophila_2:1625394_at:383:517; Interrogation_Position=631; Antisense; GTGGAATCCGAAGCAATCCGCCGTC
>probe:Drosophila_2:1625394_at:541:45; Interrogation_Position=646; Antisense; ATCCGCCGTCTGTTTCTTTTATGTA
>probe:Drosophila_2:1625394_at:374:487; Interrogation_Position=668; Antisense; GTAGCGTAACAACACACTGCTTTAT
>probe:Drosophila_2:1625394_at:271:425; Interrogation_Position=762; Antisense; GAGAGTGCTTACATCGTCTAAACGA

Paste this into a BLAST search page for me
TGAAACGACATGACGACGGCGCCGCACGGCGCCGCAGATTTGGAACGTGTAAGGAGATCTCTGCGGACAATATATGGACAATATATCCAGCGCCGTGGAGGCGCCGTGGAGCAGTTTGGCAACCAGAGCTCCAGAAGGTCCAAGTCAAGATGCTGGTTAGCAAGGCGCATGCCGAATGCCGAGAAAGTGCTCCGCGAGCAGCCTTGGAAGCCATCATCAGCAATTCAATTGAGGTGCTCGTGGAATCCGAGTGGAATCCGAAGCAATCCGCCGTCATCCGCCGTCTGTTTCTTTTATGTAGTAGCGTAACAACACACTGCTTTATGAGAGTGCTTACATCGTCTAAACGA

Full Affymetrix probeset data:

Annotations for 1625394_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720