FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625398_at:

>probe:Drosophila_2:1625398_at:108:657; Interrogation_Position=116; Antisense; TAAGGAGCCTGCCATCGAGATCATC
>probe:Drosophila_2:1625398_at:465:43; Interrogation_Position=129; Antisense; ATCGAGATCATCAGCTGTCGAGCCC
>probe:Drosophila_2:1625398_at:444:637; Interrogation_Position=146; Antisense; TCGAGCCCTCGGATGCGTATCTGAA
>probe:Drosophila_2:1625398_at:612:541; Interrogation_Position=28; Antisense; GGATTCTTTGCCCTTTTGGCCGGAG
>probe:Drosophila_2:1625398_at:13:407; Interrogation_Position=377; Antisense; GACGTGGCAAATTTGGCTTCGCTCG
>probe:Drosophila_2:1625398_at:435:635; Interrogation_Position=395; Antisense; TCGCTCGCAGCTACGACCAGGATGA
>probe:Drosophila_2:1625398_at:553:75; Interrogation_Position=413; Antisense; AGGATGAGGCCCAGGTACCGGTTCA
>probe:Drosophila_2:1625398_at:278:647; Interrogation_Position=464; Antisense; TCAGTGAAGTTCCTTCTCCAGCTTG
>probe:Drosophila_2:1625398_at:384:629; Interrogation_Position=480; Antisense; TCCAGCTTGCCCAAAGAACTATGTG
>probe:Drosophila_2:1625398_at:347:385; Interrogation_Position=495; Antisense; GAACTATGTGTTCTCCTGCGAAGCG
>probe:Drosophila_2:1625398_at:654:121; Interrogation_Position=51; Antisense; AGCGAGTTCTCTGGGTCAGCAGGCT
>probe:Drosophila_2:1625398_at:142:697; Interrogation_Position=521; Antisense; TTATCAAGCCGGTTCCATGTGGGTA
>probe:Drosophila_2:1625398_at:60:471; Interrogation_Position=532; Antisense; GTTCCATGTGGGTACAGCTCATATT
>probe:Drosophila_2:1625398_at:289:329; Interrogation_Position=73; Antisense; GCTGGTTTGGAAGCCTCGACCTGTG

Paste this into a BLAST search page for me
TAAGGAGCCTGCCATCGAGATCATCATCGAGATCATCAGCTGTCGAGCCCTCGAGCCCTCGGATGCGTATCTGAAGGATTCTTTGCCCTTTTGGCCGGAGGACGTGGCAAATTTGGCTTCGCTCGTCGCTCGCAGCTACGACCAGGATGAAGGATGAGGCCCAGGTACCGGTTCATCAGTGAAGTTCCTTCTCCAGCTTGTCCAGCTTGCCCAAAGAACTATGTGGAACTATGTGTTCTCCTGCGAAGCGAGCGAGTTCTCTGGGTCAGCAGGCTTTATCAAGCCGGTTCCATGTGGGTAGTTCCATGTGGGTACAGCTCATATTGCTGGTTTGGAAGCCTCGACCTGTG

Full Affymetrix probeset data:

Annotations for 1625398_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720