FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625399_at:

>probe:Drosophila_2:1625399_at:358:565; Interrogation_Position=1061; Antisense; GGAATTTCTCCATCACCGTAGTTCG
>probe:Drosophila_2:1625399_at:159:217; Interrogation_Position=1087; Antisense; AAGTTGATGAACAGCCTGGGCCAGT
>probe:Drosophila_2:1625399_at:450:125; Interrogation_Position=1156; Antisense; AGCCTCTGGCTGACTAGCGTGATTT
>probe:Drosophila_2:1625399_at:216:675; Interrogation_Position=1170; Antisense; TAGCGTGATTTTCATCCTGGGCATG
>probe:Drosophila_2:1625399_at:248:349; Interrogation_Position=1190; Antisense; GCATGGGACTCAACGGTGCCATCTA
>probe:Drosophila_2:1625399_at:220:97; Interrogation_Position=1226; Antisense; AGATCAATCATCTGGACCTGTCGCC
>probe:Drosophila_2:1625399_at:677:277; Interrogation_Position=1267; Antisense; CTAATCTCCGTAACCAATTGCGTGG
>probe:Drosophila_2:1625399_at:143:247; Interrogation_Position=1282; Antisense; AATTGCGTGGCCAACTTGGTGGGTC
>probe:Drosophila_2:1625399_at:84:581; Interrogation_Position=1322; Antisense; TGGCCGGTCATGTGATCGATCCCAA
>probe:Drosophila_2:1625399_at:406:689; Interrogation_Position=1380; Antisense; TATTGCTGCTGGTGTGTTTATTTTC
>probe:Drosophila_2:1625399_at:521:697; Interrogation_Position=1413; Antisense; TTTTTATAACGTATTTGCCAGCGGC
>probe:Drosophila_2:1625399_at:373:701; Interrogation_Position=868; Antisense; TTTTATGCCATACTGGTGGCCCATG
>probe:Drosophila_2:1625399_at:729:51; Interrogation_Position=928; Antisense; ATGCTGCCCACCTATATGTACAGAG
>probe:Drosophila_2:1625399_at:144:229; Interrogation_Position=976; Antisense; AATGGCATAATATCCTCGCTGCCCT

Paste this into a BLAST search page for me
GGAATTTCTCCATCACCGTAGTTCGAAGTTGATGAACAGCCTGGGCCAGTAGCCTCTGGCTGACTAGCGTGATTTTAGCGTGATTTTCATCCTGGGCATGGCATGGGACTCAACGGTGCCATCTAAGATCAATCATCTGGACCTGTCGCCCTAATCTCCGTAACCAATTGCGTGGAATTGCGTGGCCAACTTGGTGGGTCTGGCCGGTCATGTGATCGATCCCAATATTGCTGCTGGTGTGTTTATTTTCTTTTTATAACGTATTTGCCAGCGGCTTTTATGCCATACTGGTGGCCCATGATGCTGCCCACCTATATGTACAGAGAATGGCATAATATCCTCGCTGCCCT

Full Affymetrix probeset data:

Annotations for 1625399_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720