FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625400_at:

>probe:Drosophila_2:1625400_at:400:411; Interrogation_Position=124; Antisense; GACGCGAACGCGGTGATTCTCAAGC
>probe:Drosophila_2:1625400_at:499:463; Interrogation_Position=138; Antisense; GATTCTCAAGCAGAACTTCGACCTG
>probe:Drosophila_2:1625400_at:120:107; Interrogation_Position=149; Antisense; AGAACTTCGACCTGAATCCCGATGG
>probe:Drosophila_2:1625400_at:567:45; Interrogation_Position=164; Antisense; ATCCCGATGGCTCCTATCAGTACAA
>probe:Drosophila_2:1625400_at:321:671; Interrogation_Position=190; Antisense; TACGAGACAAGCAACGGAATCCGAG
>probe:Drosophila_2:1625400_at:355:47; Interrogation_Position=208; Antisense; ATCCGAGCGGATGAGGCTGGCTATT
>probe:Drosophila_2:1625400_at:632:285; Interrogation_Position=223; Antisense; GCTGGCTATTTGAAGAACCCGGGCA
>probe:Drosophila_2:1625400_at:271:381; Interrogation_Position=237; Antisense; GAACCCGGGCAGTCAGATCGAGGCT
>probe:Drosophila_2:1625400_at:239:71; Interrogation_Position=257; Antisense; AGGCTCAGGTGATGCAGGGCTCCTA
>probe:Drosophila_2:1625400_at:140:407; Interrogation_Position=293; Antisense; GACCCGATGGCGTGGTCTACACCAT
>probe:Drosophila_2:1625400_at:361:667; Interrogation_Position=310; Antisense; TACACCATCACCTACATTGCTGATG
>probe:Drosophila_2:1625400_at:255:57; Interrogation_Position=332; Antisense; ATGAGAACGGATACCGCGCCGAAGG
>probe:Drosophila_2:1625400_at:514:319; Interrogation_Position=394; Antisense; GCCGCTCCCGGAAGATTCTTCAAGT
>probe:Drosophila_2:1625400_at:104:267; Interrogation_Position=66; Antisense; CAGTTTCATTCAGGCGCAGCCACAA

Paste this into a BLAST search page for me
GACGCGAACGCGGTGATTCTCAAGCGATTCTCAAGCAGAACTTCGACCTGAGAACTTCGACCTGAATCCCGATGGATCCCGATGGCTCCTATCAGTACAATACGAGACAAGCAACGGAATCCGAGATCCGAGCGGATGAGGCTGGCTATTGCTGGCTATTTGAAGAACCCGGGCAGAACCCGGGCAGTCAGATCGAGGCTAGGCTCAGGTGATGCAGGGCTCCTAGACCCGATGGCGTGGTCTACACCATTACACCATCACCTACATTGCTGATGATGAGAACGGATACCGCGCCGAAGGGCCGCTCCCGGAAGATTCTTCAAGTCAGTTTCATTCAGGCGCAGCCACAA

Full Affymetrix probeset data:

Annotations for 1625400_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720