FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625401_at:

>probe:Drosophila_2:1625401_at:33:509; Interrogation_Position=109; Antisense; GTGCTGTCTCATGCCAGCTTTGCAA
>probe:Drosophila_2:1625401_at:183:117; Interrogation_Position=124; Antisense; AGCTTTGCAACTGCCACAAATGGAG
>probe:Drosophila_2:1625401_at:714:475; Interrogation_Position=148; Antisense; GTTATTCCAGCAGTGATTCCGGCAG
>probe:Drosophila_2:1625401_at:283:83; Interrogation_Position=159; Antisense; AGTGATTCCGGCAGTGCCCGCTACT
>probe:Drosophila_2:1625401_at:137:129; Interrogation_Position=208; Antisense; ACCAGCCATCAGTTTGTCACTCGAA
>probe:Drosophila_2:1625401_at:62:481; Interrogation_Position=219; Antisense; GTTTGTCACTCGAAACTGGAATCGA
>probe:Drosophila_2:1625401_at:463:307; Interrogation_Position=269; Antisense; CCACTTATCCCAACACCTATGTTAA
>probe:Drosophila_2:1625401_at:207:217; Interrogation_Position=292; Antisense; AAGTACAGCGGTGGCTATCCGGCGT
>probe:Drosophila_2:1625401_at:36:447; Interrogation_Position=30; Antisense; GATCGAGTGGCCCAGGTTACTTACC
>probe:Drosophila_2:1625401_at:702:665; Interrogation_Position=367; Antisense; TACTACTATCCCACTTATAACGTTG
>probe:Drosophila_2:1625401_at:358:79; Interrogation_Position=43; Antisense; AGGTTACTTACCCTCATCATGAAGA
>probe:Drosophila_2:1625401_at:698:375; Interrogation_Position=63; Antisense; GAAGAGCCTTTTTGCTACCATGTTG
>probe:Drosophila_2:1625401_at:458:127; Interrogation_Position=79; Antisense; ACCATGTTGGGCTACTTGCTCCTTG
>probe:Drosophila_2:1625401_at:591:619; Interrogation_Position=95; Antisense; TGCTCCTTGGGTTGGTGCTGTCTCA

Paste this into a BLAST search page for me
GTGCTGTCTCATGCCAGCTTTGCAAAGCTTTGCAACTGCCACAAATGGAGGTTATTCCAGCAGTGATTCCGGCAGAGTGATTCCGGCAGTGCCCGCTACTACCAGCCATCAGTTTGTCACTCGAAGTTTGTCACTCGAAACTGGAATCGACCACTTATCCCAACACCTATGTTAAAAGTACAGCGGTGGCTATCCGGCGTGATCGAGTGGCCCAGGTTACTTACCTACTACTATCCCACTTATAACGTTGAGGTTACTTACCCTCATCATGAAGAGAAGAGCCTTTTTGCTACCATGTTGACCATGTTGGGCTACTTGCTCCTTGTGCTCCTTGGGTTGGTGCTGTCTCA

Full Affymetrix probeset data:

Annotations for 1625401_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720