Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625402_at:

>probe:Drosophila_2:1625402_at:506:177; Interrogation_Position=1036; Antisense; AAACTATTCATAACCCATGCGGGCA
>probe:Drosophila_2:1625402_at:438:683; Interrogation_Position=1084; Antisense; TATCATGGAGTTCCCATGGTCGCGC
>probe:Drosophila_2:1625402_at:506:339; Interrogation_Position=1107; Antisense; GCTACCGATCTTTGGCGATCAACAG
>probe:Drosophila_2:1625402_at:624:729; Interrogation_Position=1163; Antisense; TTGGCCGATGGTTGGATATTCTCAC
>probe:Drosophila_2:1625402_at:701:551; Interrogation_Position=1206; Antisense; GGAGCAGACTATCCGTGAGGTCCTT
>probe:Drosophila_2:1625402_at:185:563; Interrogation_Position=1232; Antisense; GGAATCCCGCGTATCGTGAGACGAT
>probe:Drosophila_2:1625402_at:724:407; Interrogation_Position=1251; Antisense; GACGATTGGAAAGTTCTCCACCCTT
>probe:Drosophila_2:1625402_at:486:707; Interrogation_Position=1275; Antisense; TTACAGGGATCGTCCGTTAACAGCC
>probe:Drosophila_2:1625402_at:363:691; Interrogation_Position=1331; Antisense; TATTGCGTCATCAAGGAGCCCTTCA
>probe:Drosophila_2:1625402_at:530:495; Interrogation_Position=1364; Antisense; GTCCCCTCATTCACACAAAATTTGT
>probe:Drosophila_2:1625402_at:495:65; Interrogation_Position=1412; Antisense; ATGGAGTAGTTCTCCTGGTCAGTCT
>probe:Drosophila_2:1625402_at:403:591; Interrogation_Position=1427; Antisense; TGGTCAGTCTTCTACTCATAGTCAC
>probe:Drosophila_2:1625402_at:452:59; Interrogation_Position=1481; Antisense; ATGTTGCGATTGGTTACGGTAGTCA
>probe:Drosophila_2:1625402_at:341:395; Interrogation_Position=968; Antisense; GAAATGCCTCCAACATATTCTTCGG

Paste this into a BLAST search page for me
AAACTATTCATAACCCATGCGGGCATATCATGGAGTTCCCATGGTCGCGCGCTACCGATCTTTGGCGATCAACAGTTGGCCGATGGTTGGATATTCTCACGGAGCAGACTATCCGTGAGGTCCTTGGAATCCCGCGTATCGTGAGACGATGACGATTGGAAAGTTCTCCACCCTTTTACAGGGATCGTCCGTTAACAGCCTATTGCGTCATCAAGGAGCCCTTCAGTCCCCTCATTCACACAAAATTTGTATGGAGTAGTTCTCCTGGTCAGTCTTGGTCAGTCTTCTACTCATAGTCACATGTTGCGATTGGTTACGGTAGTCAGAAATGCCTCCAACATATTCTTCGG

Full Affymetrix probeset data:

Annotations for 1625402_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime