Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625403_at:

>probe:Drosophila_2:1625403_at:540:27; Interrogation_Position=1054; Antisense; ATACGCCCCATCACTTTGGAACTGT
>probe:Drosophila_2:1625403_at:695:663; Interrogation_Position=1113; Antisense; TACGGTTCTCAAGCGAGTCTACGGA
>probe:Drosophila_2:1625403_at:651:665; Interrogation_Position=553; Antisense; TACATTCCGTACACCAGTCTGATTG
>probe:Drosophila_2:1625403_at:716:581; Interrogation_Position=638; Antisense; TGGCGCTTAAGCATCCGTACGGAGA
>probe:Drosophila_2:1625403_at:355:551; Interrogation_Position=658; Antisense; GGAGATCGCGATCCCCGTGAACTGA
>probe:Drosophila_2:1625403_at:470:551; Interrogation_Position=687; Antisense; GGAGATCATAGCCTGCATACGTTAC
>probe:Drosophila_2:1625403_at:549:345; Interrogation_Position=701; Antisense; GCATACGTTACCAGCAGAGCATTAT
>probe:Drosophila_2:1625403_at:16:611; Interrogation_Position=752; Antisense; TGACCACCATGATGTTCCTATTCGA
>probe:Drosophila_2:1625403_at:508:721; Interrogation_Position=766; Antisense; TTCCTATTCGAACTGATGGCCTTTT
>probe:Drosophila_2:1625403_at:335:323; Interrogation_Position=805; Antisense; GCGCTGCTCTTTATGCTGATTATCG
>probe:Drosophila_2:1625403_at:105:605; Interrogation_Position=821; Antisense; TGATTATCGTCAGCGGCACCAGTCA
>probe:Drosophila_2:1625403_at:127:671; Interrogation_Position=890; Antisense; TACTGGCCCTCTATTGGTATGCAAA
>probe:Drosophila_2:1625403_at:242:389; Interrogation_Position=958; Antisense; GAAACGGAGTGGTTCACCTTCGACG
>probe:Drosophila_2:1625403_at:489:719; Interrogation_Position=983; Antisense; TTCCACTGCGCAAAAACATCCTGTT

Paste this into a BLAST search page for me
ATACGCCCCATCACTTTGGAACTGTTACGGTTCTCAAGCGAGTCTACGGATACATTCCGTACACCAGTCTGATTGTGGCGCTTAAGCATCCGTACGGAGAGGAGATCGCGATCCCCGTGAACTGAGGAGATCATAGCCTGCATACGTTACGCATACGTTACCAGCAGAGCATTATTGACCACCATGATGTTCCTATTCGATTCCTATTCGAACTGATGGCCTTTTGCGCTGCTCTTTATGCTGATTATCGTGATTATCGTCAGCGGCACCAGTCATACTGGCCCTCTATTGGTATGCAAAGAAACGGAGTGGTTCACCTTCGACGTTCCACTGCGCAAAAACATCCTGTT

Full Affymetrix probeset data:

Annotations for 1625403_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime