FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625405_at:

>probe:Drosophila_2:1625405_at:221:693; Interrogation_Position=1022; Antisense; TTTCGAACCGCGTGCTGCAAAACGA
>probe:Drosophila_2:1625405_at:107:413; Interrogation_Position=1056; Antisense; GACCGCTGGCGATTCGTATTACGAT
>probe:Drosophila_2:1625405_at:184:213; Interrogation_Position=1175; Antisense; AAGACGCCATTGCTTGTTGGAACAT
>probe:Drosophila_2:1625405_at:397:357; Interrogation_Position=1248; Antisense; GCACACTCTGGTCTTTCCAAATGAC
>probe:Drosophila_2:1625405_at:216:259; Interrogation_Position=1293; Antisense; CACTATTTGGGTGCTGTCCGACAAG
>probe:Drosophila_2:1625405_at:297:725; Interrogation_Position=1330; Antisense; TTGTACAAGGAACTCGATCCCTCGG
>probe:Drosophila_2:1625405_at:504:281; Interrogation_Position=1350; Antisense; CTCGGCCGTCAACTATCGTATTTTG
>probe:Drosophila_2:1625405_at:424:685; Interrogation_Position=1370; Antisense; TTTTGATGGGCCAGAACCGCGATCT
>probe:Drosophila_2:1625405_at:232:297; Interrogation_Position=1387; Antisense; CGCGATCTCATCAAGGGTACACCAT
>probe:Drosophila_2:1625405_at:393:153; Interrogation_Position=1443; Antisense; ACATGCTGTGTTTATGACGCGGTGC
>probe:Drosophila_2:1625405_at:474:411; Interrogation_Position=1458; Antisense; GACGCGGTGCATTTTTGTATTTACA
>probe:Drosophila_2:1625405_at:435:577; Interrogation_Position=945; Antisense; GGCCGTGGGCCCAATGAATCCAGAT
>probe:Drosophila_2:1625405_at:665:225; Interrogation_Position=976; Antisense; AAGGACATTTATTTCCATGCCCTGG
>probe:Drosophila_2:1625405_at:58:51; Interrogation_Position=992; Antisense; ATGCCCTGGCCAGTACCAAGGAGTT

Paste this into a BLAST search page for me
TTTCGAACCGCGTGCTGCAAAACGAGACCGCTGGCGATTCGTATTACGATAAGACGCCATTGCTTGTTGGAACATGCACACTCTGGTCTTTCCAAATGACCACTATTTGGGTGCTGTCCGACAAGTTGTACAAGGAACTCGATCCCTCGGCTCGGCCGTCAACTATCGTATTTTGTTTTGATGGGCCAGAACCGCGATCTCGCGATCTCATCAAGGGTACACCATACATGCTGTGTTTATGACGCGGTGCGACGCGGTGCATTTTTGTATTTACAGGCCGTGGGCCCAATGAATCCAGATAAGGACATTTATTTCCATGCCCTGGATGCCCTGGCCAGTACCAAGGAGTT

Full Affymetrix probeset data:

Annotations for 1625405_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720