FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625408_at:

>probe:Drosophila_2:1625408_at:283:103; Interrogation_Position=413; Antisense; AGAGCCTCAGCTTGGACAACTTCAA
>probe:Drosophila_2:1625408_at:248:659; Interrogation_Position=465; Antisense; TAACTCCCTGGAGGTAATACCCTTG
>probe:Drosophila_2:1625408_at:238:241; Interrogation_Position=480; Antisense; AATACCCTTGAGTTTGGCAGACACC
>probe:Drosophila_2:1625408_at:276:157; Interrogation_Position=500; Antisense; ACACCAATATGTCACTACCCTTTGT
>probe:Drosophila_2:1625408_at:363:337; Interrogation_Position=528; Antisense; GCTCGATCTTTCCTGCAACAAATTC
>probe:Drosophila_2:1625408_at:52:151; Interrogation_Position=558; Antisense; AATTTCTACGAGCTTTTTTGCCCAG
>probe:Drosophila_2:1625408_at:528:625; Interrogation_Position=576; Antisense; TGCCCAGCGATTGCCTCAGTTGAAA
>probe:Drosophila_2:1625408_at:64:473; Interrogation_Position=679; Antisense; GTTCTCAGTCACAACAACATCTCGG
>probe:Drosophila_2:1625408_at:529:189; Interrogation_Position=717; Antisense; AACATTTTTGGCACTACCGAATCTG
>probe:Drosophila_2:1625408_at:155:589; Interrogation_Position=749; Antisense; TGGATTTATCCCATAACCGCTTGAG
>probe:Drosophila_2:1625408_at:699:31; Interrogation_Position=761; Antisense; ATAACCGCTTGAGTGGATCCGCTAT
>probe:Drosophila_2:1625408_at:467:639; Interrogation_Position=786; Antisense; TCGTGCTCTGCAAGGAATTCCGGAT
>probe:Drosophila_2:1625408_at:520:93; Interrogation_Position=863; Antisense; AGTTCGTTGCTTCCTGGAGCCTAAA
>probe:Drosophila_2:1625408_at:616:259; Interrogation_Position=906; Antisense; CACTGGATTGTGTCAGGTGCCTGCA

Paste this into a BLAST search page for me
AGAGCCTCAGCTTGGACAACTTCAATAACTCCCTGGAGGTAATACCCTTGAATACCCTTGAGTTTGGCAGACACCACACCAATATGTCACTACCCTTTGTGCTCGATCTTTCCTGCAACAAATTCAATTTCTACGAGCTTTTTTGCCCAGTGCCCAGCGATTGCCTCAGTTGAAAGTTCTCAGTCACAACAACATCTCGGAACATTTTTGGCACTACCGAATCTGTGGATTTATCCCATAACCGCTTGAGATAACCGCTTGAGTGGATCCGCTATTCGTGCTCTGCAAGGAATTCCGGATAGTTCGTTGCTTCCTGGAGCCTAAACACTGGATTGTGTCAGGTGCCTGCA

Full Affymetrix probeset data:

Annotations for 1625408_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720