Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625409_at:

>probe:Drosophila_2:1625409_at:101:149; Interrogation_Position=1127; Antisense; ACTTTATAGCCACCGGGCTGAGGCA
>probe:Drosophila_2:1625409_at:133:439; Interrogation_Position=1146; Antisense; GAGGCAGTTGCTCATCGAGATGTAC
>probe:Drosophila_2:1625409_at:475:671; Interrogation_Position=1186; Antisense; TACGAGATGGTGCAACTGCCGGACC
>probe:Drosophila_2:1625409_at:15:627; Interrogation_Position=1202; Antisense; TGCCGGACCACCAATTGGAGCGCAA
>probe:Drosophila_2:1625409_at:405:683; Interrogation_Position=1235; Antisense; TATGCCGCCAAGTGCTGAGAGTGCT
>probe:Drosophila_2:1625409_at:272:425; Interrogation_Position=1251; Antisense; GAGAGTGCTGAACACCTTCGAACCG
>probe:Drosophila_2:1625409_at:87:381; Interrogation_Position=1270; Antisense; GAACCGGGTCTGAGTCGAACACGCG
>probe:Drosophila_2:1625409_at:482:133; Interrogation_Position=1290; Antisense; ACGCGCCATGAATCTTTACGAGCTG
>probe:Drosophila_2:1625409_at:619:707; Interrogation_Position=1305; Antisense; TTACGAGCTGCACGTGCCACTGGTG
>probe:Drosophila_2:1625409_at:563:83; Interrogation_Position=1342; Antisense; AGTGGCTTCATAGCCGGCAAGCTGA
>probe:Drosophila_2:1625409_at:576:637; Interrogation_Position=1391; Antisense; TCGTCGACGCCATAGATCTGCTGAA
>probe:Drosophila_2:1625409_at:194:433; Interrogation_Position=1463; Antisense; GAGTGCTGTGCGTTGTGGCCAAACA
>probe:Drosophila_2:1625409_at:707:151; Interrogation_Position=1576; Antisense; ACAGTTCTGGGTTTCTAGGGACACA
>probe:Drosophila_2:1625409_at:430:185; Interrogation_Position=1626; Antisense; AAAATCTTATTGGTGCGCTGGTCGA

Paste this into a BLAST search page for me
ACTTTATAGCCACCGGGCTGAGGCAGAGGCAGTTGCTCATCGAGATGTACTACGAGATGGTGCAACTGCCGGACCTGCCGGACCACCAATTGGAGCGCAATATGCCGCCAAGTGCTGAGAGTGCTGAGAGTGCTGAACACCTTCGAACCGGAACCGGGTCTGAGTCGAACACGCGACGCGCCATGAATCTTTACGAGCTGTTACGAGCTGCACGTGCCACTGGTGAGTGGCTTCATAGCCGGCAAGCTGATCGTCGACGCCATAGATCTGCTGAAGAGTGCTGTGCGTTGTGGCCAAACAACAGTTCTGGGTTTCTAGGGACACAAAAATCTTATTGGTGCGCTGGTCGA

Full Affymetrix probeset data:

Annotations for 1625409_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime