FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625410_at:

>probe:Drosophila_2:1625410_at:471:97; Interrogation_Position=1008; Antisense; AGATCTTTCTCATGCAACTGCCAGA
>probe:Drosophila_2:1625410_at:667:517; Interrogation_Position=1044; Antisense; GTGTGGGCGACGATTCCGAAGATCC
>probe:Drosophila_2:1625410_at:8:367; Interrogation_Position=1103; Antisense; GAATCGGAACCAGCAAGTCCTGCAG
>probe:Drosophila_2:1625410_at:721:309; Interrogation_Position=1146; Antisense; CCAAGGGCAGTGTACTACGGCAGCT
>probe:Drosophila_2:1625410_at:635:283; Interrogation_Position=1196; Antisense; CTGAGGTACAAATCCGGTCGCGTTA
>probe:Drosophila_2:1625410_at:606:527; Interrogation_Position=1233; Antisense; GGGACACACGCTTTGACTTGGATAT
>probe:Drosophila_2:1625410_at:275:45; Interrogation_Position=1266; Antisense; ATCCGGGTTTTCTGCAGGAACTCAT
>probe:Drosophila_2:1625410_at:559:73; Interrogation_Position=1281; Antisense; AGGAACTCATGTCTGTAACCGCCAA
>probe:Drosophila_2:1625410_at:322:169; Interrogation_Position=1360; Antisense; AAAGGCCACTCCAGATTGGGTGCAC
>probe:Drosophila_2:1625410_at:636:701; Interrogation_Position=1386; Antisense; TTTTCCAGCAGCAGGATGCGGCATC
>probe:Drosophila_2:1625410_at:423:49; Interrogation_Position=1401; Antisense; ATGCGGCATCCAAGCGAACGAATCC
>probe:Drosophila_2:1625410_at:15:383; Interrogation_Position=1416; Antisense; GAACGAATCCAGTACCGGGCACGTA
>probe:Drosophila_2:1625410_at:688:679; Interrogation_Position=1479; Antisense; TAGGCTGCGCCTAAGCTTAAGTTAT
>probe:Drosophila_2:1625410_at:721:1; Interrogation_Position=977; Antisense; ATTGGTAACTTTCTGGACTCCAGCG

Paste this into a BLAST search page for me
AGATCTTTCTCATGCAACTGCCAGAGTGTGGGCGACGATTCCGAAGATCCGAATCGGAACCAGCAAGTCCTGCAGCCAAGGGCAGTGTACTACGGCAGCTCTGAGGTACAAATCCGGTCGCGTTAGGGACACACGCTTTGACTTGGATATATCCGGGTTTTCTGCAGGAACTCATAGGAACTCATGTCTGTAACCGCCAAAAAGGCCACTCCAGATTGGGTGCACTTTTCCAGCAGCAGGATGCGGCATCATGCGGCATCCAAGCGAACGAATCCGAACGAATCCAGTACCGGGCACGTATAGGCTGCGCCTAAGCTTAAGTTATATTGGTAACTTTCTGGACTCCAGCG

Full Affymetrix probeset data:

Annotations for 1625410_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720