FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625411_at:

>probe:Drosophila_2:1625411_at:400:577; Interrogation_Position=2056; Antisense; GGCCCAGATATGGAGCCTGCTGCTG
>probe:Drosophila_2:1625411_at:503:61; Interrogation_Position=2106; Antisense; ATGTGACCAAGGTGTTCGTCTCCCA
>probe:Drosophila_2:1625411_at:376:551; Interrogation_Position=2182; Antisense; GGAGAACGTCCACGAGATGCCACCA
>probe:Drosophila_2:1625411_at:588:131; Interrogation_Position=2206; Antisense; ACCCGTTCAGGCAGTCTACGACGAA
>probe:Drosophila_2:1625411_at:676:415; Interrogation_Position=2239; Antisense; GAGCCTGAGCTGTCGGAATATCTTC
>probe:Drosophila_2:1625411_at:352:365; Interrogation_Position=2254; Antisense; GAATATCTTCCTCAGCGTTGGCTAC
>probe:Drosophila_2:1625411_at:644:465; Interrogation_Position=2270; Antisense; GTTGGCTACGAGTTCCATGTGGCAC
>probe:Drosophila_2:1625411_at:64:65; Interrogation_Position=2286; Antisense; ATGTGGCACATCTGGCTATGGTGGA
>probe:Drosophila_2:1625411_at:300:595; Interrogation_Position=2358; Antisense; TGGGCCAGCGGCATGACCTGGAATT
>probe:Drosophila_2:1625411_at:436:5; Interrogation_Position=2396; Antisense; ATTGAGGTGGCGCTTCCTCTGAGCA
>probe:Drosophila_2:1625411_at:61:301; Interrogation_Position=2425; Antisense; CGCCATGTTCTACCGGATGCAAACA
>probe:Drosophila_2:1625411_at:698:249; Interrogation_Position=2461; Antisense; CAATGGAGCTGCAGTGGGCATCGCT
>probe:Drosophila_2:1625411_at:266:333; Interrogation_Position=2483; Antisense; GCTGGCCATCTAGTGCTGGTGGAAA
>probe:Drosophila_2:1625411_at:205:449; Interrogation_Position=2535; Antisense; GATCCATGCAACTTTGCCTCTAGAA

Paste this into a BLAST search page for me
GGCCCAGATATGGAGCCTGCTGCTGATGTGACCAAGGTGTTCGTCTCCCAGGAGAACGTCCACGAGATGCCACCAACCCGTTCAGGCAGTCTACGACGAAGAGCCTGAGCTGTCGGAATATCTTCGAATATCTTCCTCAGCGTTGGCTACGTTGGCTACGAGTTCCATGTGGCACATGTGGCACATCTGGCTATGGTGGATGGGCCAGCGGCATGACCTGGAATTATTGAGGTGGCGCTTCCTCTGAGCACGCCATGTTCTACCGGATGCAAACACAATGGAGCTGCAGTGGGCATCGCTGCTGGCCATCTAGTGCTGGTGGAAAGATCCATGCAACTTTGCCTCTAGAA

Full Affymetrix probeset data:

Annotations for 1625411_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720