Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625412_at:

>probe:Drosophila_2:1625412_at:414:285; Interrogation_Position=1000; Antisense; CTGACCGTCATCTCGTATTACATTA
>probe:Drosophila_2:1625412_at:68:659; Interrogation_Position=1023; Antisense; TAAGCGGCACAAGTGGTCGTCGCTC
>probe:Drosophila_2:1625412_at:292:501; Interrogation_Position=1038; Antisense; GTCGTCGCTCAAGTCGCGGAAGATT
>probe:Drosophila_2:1625412_at:538:563; Interrogation_Position=1055; Antisense; GGAAGATTGTGTTCGTGCCCAAGGA
>probe:Drosophila_2:1625412_at:638:229; Interrogation_Position=1119; Antisense; AATGCAGTGTTATCGCGGCTTTACC
>probe:Drosophila_2:1625412_at:135:677; Interrogation_Position=1129; Antisense; TATCGCGGCTTTACCGACTAATAAA
>probe:Drosophila_2:1625412_at:414:85; Interrogation_Position=1192; Antisense; AGTGAACAAGCAACATCCGCAACCA
>probe:Drosophila_2:1625412_at:503:45; Interrogation_Position=1206; Antisense; ATCCGCAACCACCAAGTCAATGTTC
>probe:Drosophila_2:1625412_at:166:495; Interrogation_Position=1221; Antisense; GTCAATGTTCTCTCCGCTGAAAAAT
>probe:Drosophila_2:1625412_at:138:669; Interrogation_Position=1257; Antisense; TACTATCCCAATATGCGAGAGCCAG
>probe:Drosophila_2:1625412_at:378:415; Interrogation_Position=1275; Antisense; GAGCCAGCCAACCAAACGATTCAAA
>probe:Drosophila_2:1625412_at:684:179; Interrogation_Position=1322; Antisense; AAAACATCCTTGGTAACCTACTGAT
>probe:Drosophila_2:1625412_at:517:171; Interrogation_Position=1402; Antisense; AAAGACTACAGGAGCCTAGCGAAAT
>probe:Drosophila_2:1625412_at:526:387; Interrogation_Position=1530; Antisense; GAAAATCATTTCTAGGCGGGACATC

Paste this into a BLAST search page for me
CTGACCGTCATCTCGTATTACATTATAAGCGGCACAAGTGGTCGTCGCTCGTCGTCGCTCAAGTCGCGGAAGATTGGAAGATTGTGTTCGTGCCCAAGGAAATGCAGTGTTATCGCGGCTTTACCTATCGCGGCTTTACCGACTAATAAAAGTGAACAAGCAACATCCGCAACCAATCCGCAACCACCAAGTCAATGTTCGTCAATGTTCTCTCCGCTGAAAAATTACTATCCCAATATGCGAGAGCCAGGAGCCAGCCAACCAAACGATTCAAAAAAACATCCTTGGTAACCTACTGATAAAGACTACAGGAGCCTAGCGAAATGAAAATCATTTCTAGGCGGGACATC

Full Affymetrix probeset data:

Annotations for 1625412_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime