FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625414_at:

>probe:Drosophila_2:1625414_at:418:665; Interrogation_Position=1228; Antisense; TACACCGTAGAGACATTTACAGCGG
>probe:Drosophila_2:1625414_at:180:27; Interrogation_Position=1285; Antisense; ATAGCACCAGCTAATCTCTGTGATT
>probe:Drosophila_2:1625414_at:601:9; Interrogation_Position=1321; Antisense; ATTCGGACACTTGCAGCGGCTGATA
>probe:Drosophila_2:1625414_at:7:487; Interrogation_Position=1389; Antisense; GTGAGCTTAGTTAGGTTCGTTGGCC
>probe:Drosophila_2:1625414_at:697:715; Interrogation_Position=1404; Antisense; TTCGTTGGCCTAACTGAGAGGCACT
>probe:Drosophila_2:1625414_at:256:425; Interrogation_Position=1419; Antisense; GAGAGGCACTTTCGAGCGCTTTAAT
>probe:Drosophila_2:1625414_at:23:315; Interrogation_Position=1434; Antisense; GCGCTTTAATTAATTGTTACCTCAT
>probe:Drosophila_2:1625414_at:627:391; Interrogation_Position=1465; Antisense; GAAAGCCTGTTAAATCTAGTGTGTA
>probe:Drosophila_2:1625414_at:620:689; Interrogation_Position=1538; Antisense; TATTGCTTTCAGATCATTTATGTGC
>probe:Drosophila_2:1625414_at:116:455; Interrogation_Position=1579; Antisense; GATCAATCTTAATCCTTATCGCCGC
>probe:Drosophila_2:1625414_at:561:577; Interrogation_Position=1610; Antisense; GGCCGATAGCAAGCCACTAATCAAG
>probe:Drosophila_2:1625414_at:3:457; Interrogation_Position=1653; Antisense; GATAGACTCTTGAAACTGTTACCTA
>probe:Drosophila_2:1625414_at:254:533; Interrogation_Position=1704; Antisense; GGGTGGCTGCATGTACAGAATACAC
>probe:Drosophila_2:1625414_at:30:729; Interrogation_Position=1774; Antisense; TTGTAACGACTCTGTGACCAATTAA

Paste this into a BLAST search page for me
TACACCGTAGAGACATTTACAGCGGATAGCACCAGCTAATCTCTGTGATTATTCGGACACTTGCAGCGGCTGATAGTGAGCTTAGTTAGGTTCGTTGGCCTTCGTTGGCCTAACTGAGAGGCACTGAGAGGCACTTTCGAGCGCTTTAATGCGCTTTAATTAATTGTTACCTCATGAAAGCCTGTTAAATCTAGTGTGTATATTGCTTTCAGATCATTTATGTGCGATCAATCTTAATCCTTATCGCCGCGGCCGATAGCAAGCCACTAATCAAGGATAGACTCTTGAAACTGTTACCTAGGGTGGCTGCATGTACAGAATACACTTGTAACGACTCTGTGACCAATTAA

Full Affymetrix probeset data:

Annotations for 1625414_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720