Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625417_s_at:

>probe:Drosophila_2:1625417_s_at:171:315; Interrogation_Position=208; Antisense; GCCTTAAGTGCTCCTGCTTACACTG
>probe:Drosophila_2:1625417_s_at:177:711; Interrogation_Position=211; Antisense; TTAAGTGCTCCTGCTTACACTGCTC
>probe:Drosophila_2:1625417_s_at:111:709; Interrogation_Position=225; Antisense; TTACACTGCTCCTGTGACCACATAT
>probe:Drosophila_2:1625417_s_at:538:143; Interrogation_Position=229; Antisense; ACTGCTCCTGTGACCACATATGCCG
>probe:Drosophila_2:1625417_s_at:109:335; Interrogation_Position=298; Antisense; GCTGTCGTCAGCTCTTTCTTGAAGA
>probe:Drosophila_2:1625417_s_at:475:599; Interrogation_Position=300; Antisense; TGTCGTCAGCTCTTTCTTGAAGAAG
>probe:Drosophila_2:1625417_s_at:303:639; Interrogation_Position=302; Antisense; TCGTCAGCTCTTTCTTGAAGAAGAA
>probe:Drosophila_2:1625417_s_at:667:495; Interrogation_Position=304; Antisense; GTCAGCTCTTTCTTGAAGAAGAAGT
>probe:Drosophila_2:1625417_s_at:555:5; Interrogation_Position=43; Antisense; ATTGCCGCCGCCCAGGCAGGATTCA
>probe:Drosophila_2:1625417_s_at:667:71; Interrogation_Position=56; Antisense; AGGCAGGATTCATCGCATCTCCAGT
>probe:Drosophila_2:1625417_s_at:608:567; Interrogation_Position=57; Antisense; GGCAGGATTCATCGCATCTCCAGTG
>probe:Drosophila_2:1625417_s_at:297:79; Interrogation_Position=60; Antisense; AGGATTCATCGCATCTCCAGTGGCC
>probe:Drosophila_2:1625417_s_at:244:463; Interrogation_Position=62; Antisense; GATTCATCGCATCTCCAGTGGCCAC
>probe:Drosophila_2:1625417_s_at:285:683; Interrogation_Position=88; Antisense; TATGCCGCCACCTATTCCGCAGCTG

Paste this into a BLAST search page for me
GCCTTAAGTGCTCCTGCTTACACTGTTAAGTGCTCCTGCTTACACTGCTCTTACACTGCTCCTGTGACCACATATACTGCTCCTGTGACCACATATGCCGGCTGTCGTCAGCTCTTTCTTGAAGATGTCGTCAGCTCTTTCTTGAAGAAGTCGTCAGCTCTTTCTTGAAGAAGAAGTCAGCTCTTTCTTGAAGAAGAAGTATTGCCGCCGCCCAGGCAGGATTCAAGGCAGGATTCATCGCATCTCCAGTGGCAGGATTCATCGCATCTCCAGTGAGGATTCATCGCATCTCCAGTGGCCGATTCATCGCATCTCCAGTGGCCACTATGCCGCCACCTATTCCGCAGCTG

Full Affymetrix probeset data:

Annotations for 1625417_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime