Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625421_at:

>probe:Drosophila_2:1625421_at:702:215; Interrogation_Position=2584; Antisense; AAGTTCCGCCAAAGATGTCGCTTCA
>probe:Drosophila_2:1625421_at:229:641; Interrogation_Position=2630; Antisense; TCTTTTTCCTGCTGACTGTGATGGT
>probe:Drosophila_2:1625421_at:409:143; Interrogation_Position=2644; Antisense; ACTGTGATGGTGGTCAGCCTGGTTC
>probe:Drosophila_2:1625421_at:123:55; Interrogation_Position=2757; Antisense; ATGTAGCCACACCAGTTAGCTCCTA
>probe:Drosophila_2:1625421_at:26:675; Interrogation_Position=2773; Antisense; TAGCTCCTAGATCCGACTCTGGTAG
>probe:Drosophila_2:1625421_at:109:571; Interrogation_Position=2816; Antisense; GGCTCGGCGGAATATTACAAACTAC
>probe:Drosophila_2:1625421_at:560:473; Interrogation_Position=2886; Antisense; GTTAGCGGTAGTCGTAAGCTCCTGT
>probe:Drosophila_2:1625421_at:449:207; Interrogation_Position=2901; Antisense; AAGCTCCTGTGGTATTTCTTGGCAG
>probe:Drosophila_2:1625421_at:538:125; Interrogation_Position=2946; Antisense; AGCCGCAGTCGCAGTATTGTTAATA
>probe:Drosophila_2:1625421_at:424:705; Interrogation_Position=3005; Antisense; TTAGTGCATTTGTTTCCGTGCGTAC
>probe:Drosophila_2:1625421_at:437:507; Interrogation_Position=3022; Antisense; GTGCGTACGCGTATACTGCCTGTAT
>probe:Drosophila_2:1625421_at:417:627; Interrogation_Position=3038; Antisense; TGCCTGTATCCAGCCTATGTATATC
>probe:Drosophila_2:1625421_at:333:483; Interrogation_Position=3056; Antisense; GTATATCCTTTGTCACAGCTATCCA
>probe:Drosophila_2:1625421_at:62:245; Interrogation_Position=3119; Antisense; AATTATAGCTAGATTCGTCCTGTGA

Paste this into a BLAST search page for me
AAGTTCCGCCAAAGATGTCGCTTCATCTTTTTCCTGCTGACTGTGATGGTACTGTGATGGTGGTCAGCCTGGTTCATGTAGCCACACCAGTTAGCTCCTATAGCTCCTAGATCCGACTCTGGTAGGGCTCGGCGGAATATTACAAACTACGTTAGCGGTAGTCGTAAGCTCCTGTAAGCTCCTGTGGTATTTCTTGGCAGAGCCGCAGTCGCAGTATTGTTAATATTAGTGCATTTGTTTCCGTGCGTACGTGCGTACGCGTATACTGCCTGTATTGCCTGTATCCAGCCTATGTATATCGTATATCCTTTGTCACAGCTATCCAAATTATAGCTAGATTCGTCCTGTGA

Full Affymetrix probeset data:

Annotations for 1625421_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime