Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625422_at:

>probe:Drosophila_2:1625422_at:223:351; Interrogation_Position=1934; Antisense; GCAGCAAGATCTCCAGGCGGTACCG
>probe:Drosophila_2:1625422_at:511:87; Interrogation_Position=1967; Antisense; AGTCCTCGTAGAGCGAATTCTGCGA
>probe:Drosophila_2:1625422_at:370:535; Interrogation_Position=2087; Antisense; GGTGCAGCACTACATGCTCAGGGAT
>probe:Drosophila_2:1625422_at:711:81; Interrogation_Position=2106; Antisense; AGGGATCAGACTGCCGGCGCATTAA
>probe:Drosophila_2:1625422_at:122:345; Interrogation_Position=2124; Antisense; GCATTAACCACATCGCGGAGCGATC
>probe:Drosophila_2:1625422_at:677:261; Interrogation_Position=2191; Antisense; CAGCCATCTATGGTGGTGGATCATC
>probe:Drosophila_2:1625422_at:29:107; Interrogation_Position=2230; Antisense; AGAATAAAGCCATGTCCCTCGAACT
>probe:Drosophila_2:1625422_at:170:503; Interrogation_Position=2243; Antisense; GTCCCTCGAACTTTCTCTAGAGATT
>probe:Drosophila_2:1625422_at:587:207; Interrogation_Position=2281; Antisense; AAGCTGTGCTCGAGGATACGCTCTT
>probe:Drosophila_2:1625422_at:543:379; Interrogation_Position=2327; Antisense; GAACCTCGATGTGTTGGGACTCGAA
>probe:Drosophila_2:1625422_at:29:651; Interrogation_Position=2362; Antisense; TCACGAGGAAATTGCGCTCCCTGGA
>probe:Drosophila_2:1625422_at:630:233; Interrogation_Position=2402; Antisense; AATGCCAGTCTTCTTATTCCATAGT
>probe:Drosophila_2:1625422_at:1:9; Interrogation_Position=2417; Antisense; ATTCCATAGTATTCCATTCCAGAGT
>probe:Drosophila_2:1625422_at:298:9; Interrogation_Position=2432; Antisense; ATTCCAGAGTCTAACCCGCGTGTAG

Paste this into a BLAST search page for me
GCAGCAAGATCTCCAGGCGGTACCGAGTCCTCGTAGAGCGAATTCTGCGAGGTGCAGCACTACATGCTCAGGGATAGGGATCAGACTGCCGGCGCATTAAGCATTAACCACATCGCGGAGCGATCCAGCCATCTATGGTGGTGGATCATCAGAATAAAGCCATGTCCCTCGAACTGTCCCTCGAACTTTCTCTAGAGATTAAGCTGTGCTCGAGGATACGCTCTTGAACCTCGATGTGTTGGGACTCGAATCACGAGGAAATTGCGCTCCCTGGAAATGCCAGTCTTCTTATTCCATAGTATTCCATAGTATTCCATTCCAGAGTATTCCAGAGTCTAACCCGCGTGTAG

Full Affymetrix probeset data:

Annotations for 1625422_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime