FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625424_at:

>probe:Drosophila_2:1625424_at:120:59; Interrogation_Position=4679; Antisense; ATGATTTTGTAATGCGTGCCTCCGC
>probe:Drosophila_2:1625424_at:229:405; Interrogation_Position=4706; Antisense; GACTCATTCATTCGTTTGCGCTTAG
>probe:Drosophila_2:1625424_at:178:723; Interrogation_Position=4721; Antisense; TTGCGCTTAGTAACATCTCATTTGA
>probe:Drosophila_2:1625424_at:328:87; Interrogation_Position=4771; Antisense; AGTCGCTGATCTTTGGTATGCTCTT
>probe:Drosophila_2:1625424_at:424:539; Interrogation_Position=4785; Antisense; GGTATGCTCTTTTGTAGGATATTTA
>probe:Drosophila_2:1625424_at:443:479; Interrogation_Position=4810; Antisense; GTTTCTATTGATTTTCTACATTCGT
>probe:Drosophila_2:1625424_at:79:641; Interrogation_Position=4824; Antisense; TCTACATTCGTTATTTCTTACCTTT
>probe:Drosophila_2:1625424_at:448:535; Interrogation_Position=4962; Antisense; GGTGCTCTTTTGGTCCAAGGATCAT
>probe:Drosophila_2:1625424_at:676:515; Interrogation_Position=5068; Antisense; GTGTGCATGGTGGACTTAATCTTAT
>probe:Drosophila_2:1625424_at:55:705; Interrogation_Position=5089; Antisense; TTATTTTGCAATGCTGTGCCTCTCC
>probe:Drosophila_2:1625424_at:304:505; Interrogation_Position=5104; Antisense; GTGCCTCTCCTTTTCAATTAGCATA
>probe:Drosophila_2:1625424_at:284:675; Interrogation_Position=5122; Antisense; TAGCATAGATTAAATTCCCCTCCCA
>probe:Drosophila_2:1625424_at:510:295; Interrogation_Position=5152; Antisense; CGACATTTCGCTGTAAGCCTTTCAG
>probe:Drosophila_2:1625424_at:547:515; Interrogation_Position=5163; Antisense; TGTAAGCCTTTCAGCCCACTAAAAG

Paste this into a BLAST search page for me
ATGATTTTGTAATGCGTGCCTCCGCGACTCATTCATTCGTTTGCGCTTAGTTGCGCTTAGTAACATCTCATTTGAAGTCGCTGATCTTTGGTATGCTCTTGGTATGCTCTTTTGTAGGATATTTAGTTTCTATTGATTTTCTACATTCGTTCTACATTCGTTATTTCTTACCTTTGGTGCTCTTTTGGTCCAAGGATCATGTGTGCATGGTGGACTTAATCTTATTTATTTTGCAATGCTGTGCCTCTCCGTGCCTCTCCTTTTCAATTAGCATATAGCATAGATTAAATTCCCCTCCCACGACATTTCGCTGTAAGCCTTTCAGTGTAAGCCTTTCAGCCCACTAAAAG

Full Affymetrix probeset data:

Annotations for 1625424_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720