Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625425_a_at:

>probe:Drosophila_2:1625425_a_at:602:511; Interrogation_Position=117; Antisense; GTGTCGACTTGGACCAGCTTCTGGA
>probe:Drosophila_2:1625425_a_at:197:153; Interrogation_Position=141; Antisense; ACATGCCCAACAACCAGCTGGTGGA
>probe:Drosophila_2:1625425_a_at:344:479; Interrogation_Position=192; Antisense; GTTTCTCCCGCGGACTGAAGCGCAA
>probe:Drosophila_2:1625425_a_at:118:133; Interrogation_Position=262; Antisense; ACCGCCAAATGAGAAGCCCGAGATT
>probe:Drosophila_2:1625425_a_at:677:93; Interrogation_Position=282; Antisense; AGATTGTCAAGACCCACCTGAGGAA
>probe:Drosophila_2:1625425_a_at:270:73; Interrogation_Position=302; Antisense; AGGAACATGATCATCGTACCCGAGA
>probe:Drosophila_2:1625425_a_at:314:99; Interrogation_Position=324; Antisense; AGATGACCGGCTCCATCATTGGCGT
>probe:Drosophila_2:1625425_a_at:586:727; Interrogation_Position=342; Antisense; TTGGCGTCTACAACGGCAAGGACTT
>probe:Drosophila_2:1625425_a_at:424:95; Interrogation_Position=390; Antisense; AGATGATCGGTCACTACCTGGGCGA
>probe:Drosophila_2:1625425_a_at:323:253; Interrogation_Position=439; Antisense; CAAGCACGGTCGTCCTGGTATCGGT
>probe:Drosophila_2:1625425_a_at:143:479; Interrogation_Position=480; Antisense; GTTTCATTCCTCTGAAGTGAGCGCT
>probe:Drosophila_2:1625425_a_at:644:283; Interrogation_Position=503; Antisense; CTGCTCGTCTTTTGGGCTGTTGAGA
>probe:Drosophila_2:1625425_a_at:702:325; Interrogation_Position=589; Antisense; GCGTTTTCCATCTAATGCTTTTCCA
>probe:Drosophila_2:1625425_a_at:609:107; Interrogation_Position=99; Antisense; AGAAGTTCACCTACCGCGGTGTCGA

Paste this into a BLAST search page for me
GTGTCGACTTGGACCAGCTTCTGGAACATGCCCAACAACCAGCTGGTGGAGTTTCTCCCGCGGACTGAAGCGCAAACCGCCAAATGAGAAGCCCGAGATTAGATTGTCAAGACCCACCTGAGGAAAGGAACATGATCATCGTACCCGAGAAGATGACCGGCTCCATCATTGGCGTTTGGCGTCTACAACGGCAAGGACTTAGATGATCGGTCACTACCTGGGCGACAAGCACGGTCGTCCTGGTATCGGTGTTTCATTCCTCTGAAGTGAGCGCTCTGCTCGTCTTTTGGGCTGTTGAGAGCGTTTTCCATCTAATGCTTTTCCAAGAAGTTCACCTACCGCGGTGTCGA

Full Affymetrix probeset data:

Annotations for 1625425_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime