FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625426_at:

>probe:Drosophila_2:1625426_at:276:417; Interrogation_Position=1086; Antisense; GAGCGCGTCAGCAGAACATTGATTA
>probe:Drosophila_2:1625426_at:191:547; Interrogation_Position=1114; Antisense; GGATGCACATGGTTTCACAGCCTTA
>probe:Drosophila_2:1625426_at:324:503; Interrogation_Position=1184; Antisense; GTCGCGGCTGGTGCCAATGTGAACA
>probe:Drosophila_2:1625426_at:188:231; Interrogation_Position=1199; Antisense; AATGTGAACACTATGGCTCCAGATT
>probe:Drosophila_2:1625426_at:436:459; Interrogation_Position=1220; Antisense; GATTTGATTAGTCCTCTACTCCTAG
>probe:Drosophila_2:1625426_at:606:31; Interrogation_Position=1260; Antisense; ATAACGAGATCGTCCGCTTCTTGCT
>probe:Drosophila_2:1625426_at:523:713; Interrogation_Position=1277; Antisense; TTCTTGCTGGAACACGGCGCTGATT
>probe:Drosophila_2:1625426_at:309:463; Interrogation_Position=1298; Antisense; GATTCGGGCCACATGGACATCGTTG
>probe:Drosophila_2:1625426_at:369:401; Interrogation_Position=1313; Antisense; GACATCGTTGGAAACACGGCGCTTA
>probe:Drosophila_2:1625426_at:132:37; Interrogation_Position=1356; Antisense; ATCATCCGCATACTTGCAACGAGCT
>probe:Drosophila_2:1625426_at:586:103; Interrogation_Position=1390; Antisense; AGACCTGGATCTAAGTGCCACCAAC
>probe:Drosophila_2:1625426_at:617:171; Interrogation_Position=1412; Antisense; AACGAGGACGGAGACACGGCCTACT
>probe:Drosophila_2:1625426_at:60:57; Interrogation_Position=1490; Antisense; ATGACGGCCATAATCACAGCGGGAG
>probe:Drosophila_2:1625426_at:190:153; Interrogation_Position=1505; Antisense; ACAGCGGGAGCCTTCGGTAGTATTT

Paste this into a BLAST search page for me
GAGCGCGTCAGCAGAACATTGATTAGGATGCACATGGTTTCACAGCCTTAGTCGCGGCTGGTGCCAATGTGAACAAATGTGAACACTATGGCTCCAGATTGATTTGATTAGTCCTCTACTCCTAGATAACGAGATCGTCCGCTTCTTGCTTTCTTGCTGGAACACGGCGCTGATTGATTCGGGCCACATGGACATCGTTGGACATCGTTGGAAACACGGCGCTTAATCATCCGCATACTTGCAACGAGCTAGACCTGGATCTAAGTGCCACCAACAACGAGGACGGAGACACGGCCTACTATGACGGCCATAATCACAGCGGGAGACAGCGGGAGCCTTCGGTAGTATTT

Full Affymetrix probeset data:

Annotations for 1625426_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720