Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625427_at:

>probe:Drosophila_2:1625427_at:682:89; Interrogation_Position=2394; Antisense; AGCTTTATTGACTCACCCGGTTGGG
>probe:Drosophila_2:1625427_at:125:277; Interrogation_Position=2459; Antisense; CTTCAATCTGAACCCCGACTGGGAA
>probe:Drosophila_2:1625427_at:563:223; Interrogation_Position=2502; Antisense; AAGGAGTCGCAACCGCTCAAGGACG
>probe:Drosophila_2:1625427_at:129:615; Interrogation_Position=2545; Antisense; TGAAGCACCATCTCTTCTCATGGGA
>probe:Drosophila_2:1625427_at:639:269; Interrogation_Position=2563; Antisense; CATGGGATCTGTGAGGCTTGCTGCC
>probe:Drosophila_2:1625427_at:404:343; Interrogation_Position=2578; Antisense; GCTTGCTGCCGCCTTGTAAGGAGCT
>probe:Drosophila_2:1625427_at:322:225; Interrogation_Position=2595; Antisense; AAGGAGCTCCACAATCGTTGGCAAT
>probe:Drosophila_2:1625427_at:330:33; Interrogation_Position=2618; Antisense; ATCAACTGCGTATCCAATATCTCAT
>probe:Drosophila_2:1625427_at:636:301; Interrogation_Position=2647; Antisense; CCCTTCTCTGTTCTTTCATTTCTAA
>probe:Drosophila_2:1625427_at:305:665; Interrogation_Position=2715; Antisense; TACTTCTTTGTTGTCGTACACCTAA
>probe:Drosophila_2:1625427_at:388:657; Interrogation_Position=2742; Antisense; TAAGTGCTTTACCATAACGATCTGT
>probe:Drosophila_2:1625427_at:311:451; Interrogation_Position=2760; Antisense; GATCTGTAGCTGTAACTATACCTTT
>probe:Drosophila_2:1625427_at:118:175; Interrogation_Position=2786; Antisense; AAACGCCCTATGTATAGCTCGAGCC
>probe:Drosophila_2:1625427_at:607:115; Interrogation_Position=2801; Antisense; AGCTCGAGCCGTTTGTTTACTTAAT

Paste this into a BLAST search page for me
AGCTTTATTGACTCACCCGGTTGGGCTTCAATCTGAACCCCGACTGGGAAAAGGAGTCGCAACCGCTCAAGGACGTGAAGCACCATCTCTTCTCATGGGACATGGGATCTGTGAGGCTTGCTGCCGCTTGCTGCCGCCTTGTAAGGAGCTAAGGAGCTCCACAATCGTTGGCAATATCAACTGCGTATCCAATATCTCATCCCTTCTCTGTTCTTTCATTTCTAATACTTCTTTGTTGTCGTACACCTAATAAGTGCTTTACCATAACGATCTGTGATCTGTAGCTGTAACTATACCTTTAAACGCCCTATGTATAGCTCGAGCCAGCTCGAGCCGTTTGTTTACTTAAT

Full Affymetrix probeset data:

Annotations for 1625427_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime