FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625428_at:

>probe:Drosophila_2:1625428_at:551:57; Interrogation_Position=106; Antisense; ATGATCGAGGCTCTGCGGGACTATA
>probe:Drosophila_2:1625428_at:485:527; Interrogation_Position=122; Antisense; GGGACTATAGCGGACCCACGATATG
>probe:Drosophila_2:1625428_at:398:419; Interrogation_Position=15; Antisense; GAGCTTAGTGCTCGAATCCGATGTG
>probe:Drosophila_2:1625428_at:536:273; Interrogation_Position=159; Antisense; CTATCCCCTTATCTTCAAAGGCACA
>probe:Drosophila_2:1625428_at:243:73; Interrogation_Position=177; Antisense; AGGCACAATCGACGAGGCACATGTC
>probe:Drosophila_2:1625428_at:394:567; Interrogation_Position=192; Antisense; GGCACATGTCGCACAAATACTCAAT
>probe:Drosophila_2:1625428_at:381:383; Interrogation_Position=267; Antisense; GAACTGCATCCATGTGGAATCCGAT
>probe:Drosophila_2:1625428_at:299:367; Interrogation_Position=283; Antisense; GAATCCGATGTGGTCACAGCTCAAA
>probe:Drosophila_2:1625428_at:326:235; Interrogation_Position=29; Antisense; AATCCGATGTGGCAGCTTTGCTGGA
>probe:Drosophila_2:1625428_at:56:119; Interrogation_Position=300; Antisense; AGCTCAAAGGCGCTCCAGATTGCTG
>probe:Drosophila_2:1625428_at:163:629; Interrogation_Position=313; Antisense; TCCAGATTGCTGTGGTTCTCCAGAA
>probe:Drosophila_2:1625428_at:235:417; Interrogation_Position=353; Antisense; GAGCTGAGCGCTTAAAGGAACCTAA
>probe:Drosophila_2:1625428_at:168:445; Interrogation_Position=52; Antisense; GATGAGGTGCGCGAATTCAACGACG
>probe:Drosophila_2:1625428_at:298:445; Interrogation_Position=87; Antisense; GATGCAGCGCCTGGACAGGATGATC

Paste this into a BLAST search page for me
ATGATCGAGGCTCTGCGGGACTATAGGGACTATAGCGGACCCACGATATGGAGCTTAGTGCTCGAATCCGATGTGCTATCCCCTTATCTTCAAAGGCACAAGGCACAATCGACGAGGCACATGTCGGCACATGTCGCACAAATACTCAATGAACTGCATCCATGTGGAATCCGATGAATCCGATGTGGTCACAGCTCAAAAATCCGATGTGGCAGCTTTGCTGGAAGCTCAAAGGCGCTCCAGATTGCTGTCCAGATTGCTGTGGTTCTCCAGAAGAGCTGAGCGCTTAAAGGAACCTAAGATGAGGTGCGCGAATTCAACGACGGATGCAGCGCCTGGACAGGATGATC

Full Affymetrix probeset data:

Annotations for 1625428_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720