Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625430_at:

>probe:Drosophila_2:1625430_at:112:661; Interrogation_Position=137; Antisense; TAAACCAGGTTGCAGGGCTTTTTCA
>probe:Drosophila_2:1625430_at:186:267; Interrogation_Position=149; Antisense; CAGGGCTTTTTCAAGTGCGAGTAAA
>probe:Drosophila_2:1625430_at:90:393; Interrogation_Position=247; Antisense; GAAATGGGCATTCCGGATATCCGAC
>probe:Drosophila_2:1625430_at:380:23; Interrogation_Position=263; Antisense; ATATCCGACTGCTGGTGACGCTGGA
>probe:Drosophila_2:1625430_at:384:135; Interrogation_Position=280; Antisense; ACGCTGGATTTCGAGGTCTATGGAC
>probe:Drosophila_2:1625430_at:699:557; Interrogation_Position=301; Antisense; GGACATGTACAAGGCCTGAATCTCA
>probe:Drosophila_2:1625430_at:338:615; Interrogation_Position=317; Antisense; TGAATCTCACGAAAGACACCCGCGA
>probe:Drosophila_2:1625430_at:457:357; Interrogation_Position=383; Antisense; GCAAACAGGGCACCATTGTGGGCAA
>probe:Drosophila_2:1625430_at:665:159; Interrogation_Position=434; Antisense; ACAAGATGATCACCTGGCTGTCCAC
>probe:Drosophila_2:1625430_at:446:165; Interrogation_Position=479; Antisense; AAATCGATCGCTGTGAGGTCCGGAA
>probe:Drosophila_2:1625430_at:599:79; Interrogation_Position=494; Antisense; AGGTCCGGAACCAGGGCAATCTCAG
>probe:Drosophila_2:1625430_at:92:263; Interrogation_Position=516; Antisense; CAGCCGACTGGACTACAAGGACTTT
>probe:Drosophila_2:1625430_at:155:63; Interrogation_Position=556; Antisense; ATGTGGTCCGGTTTGTGTGGCCTTA
>probe:Drosophila_2:1625430_at:115:603; Interrogation_Position=595; Antisense; TGTTTTGTGCATTACTTGGCTAAGT

Paste this into a BLAST search page for me
TAAACCAGGTTGCAGGGCTTTTTCACAGGGCTTTTTCAAGTGCGAGTAAAGAAATGGGCATTCCGGATATCCGACATATCCGACTGCTGGTGACGCTGGAACGCTGGATTTCGAGGTCTATGGACGGACATGTACAAGGCCTGAATCTCATGAATCTCACGAAAGACACCCGCGAGCAAACAGGGCACCATTGTGGGCAAACAAGATGATCACCTGGCTGTCCACAAATCGATCGCTGTGAGGTCCGGAAAGGTCCGGAACCAGGGCAATCTCAGCAGCCGACTGGACTACAAGGACTTTATGTGGTCCGGTTTGTGTGGCCTTATGTTTTGTGCATTACTTGGCTAAGT

Full Affymetrix probeset data:

Annotations for 1625430_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime