Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625431_at:

>probe:Drosophila_2:1625431_at:376:705; Interrogation_Position=2446; Antisense; TTAGTTTATATTTCCAATCCCTTGG
>probe:Drosophila_2:1625431_at:363:233; Interrogation_Position=2461; Antisense; AATCCCTTGGAGTTTTTCTAGCCAG
>probe:Drosophila_2:1625431_at:211:671; Interrogation_Position=2479; Antisense; TAGCCAGTCCCACACAGTTTCTAGC
>probe:Drosophila_2:1625431_at:708:477; Interrogation_Position=2495; Antisense; GTTTCTAGCCACTGTTTTCATATTG
>probe:Drosophila_2:1625431_at:637:711; Interrogation_Position=2511; Antisense; TTCATATTGCCATAGGTTCCTTTTA
>probe:Drosophila_2:1625431_at:131:565; Interrogation_Position=2565; Antisense; GGAATCCACAAGTCTTGCCAAATCA
>probe:Drosophila_2:1625431_at:146:541; Interrogation_Position=2596; Antisense; GGTTATTATGCCTGTCTAAGTCTAG
>probe:Drosophila_2:1625431_at:710:367; Interrogation_Position=2665; Antisense; GAATGCATTCCAAATGTGCCTTACC
>probe:Drosophila_2:1625431_at:716:487; Interrogation_Position=2680; Antisense; GTGCCTTACCAAAACGGGTGACGAG
>probe:Drosophila_2:1625431_at:119:85; Interrogation_Position=2703; Antisense; AGTGACCTCCCTCCAAATTGGAAAG
>probe:Drosophila_2:1625431_at:214:561; Interrogation_Position=2722; Antisense; GGAAAGCTTCGTTGCCCAACAAACT
>probe:Drosophila_2:1625431_at:176:293; Interrogation_Position=2766; Antisense; CGTAGACTAAGTTCCATTTGCTGTT
>probe:Drosophila_2:1625431_at:25:309; Interrogation_Position=2779; Antisense; CCATTTGCTGTTTTTGCTGTAGTTA
>probe:Drosophila_2:1625431_at:286:483; Interrogation_Position=2827; Antisense; GTATACTAGCTCATTTGGCTTTACA

Paste this into a BLAST search page for me
TTAGTTTATATTTCCAATCCCTTGGAATCCCTTGGAGTTTTTCTAGCCAGTAGCCAGTCCCACACAGTTTCTAGCGTTTCTAGCCACTGTTTTCATATTGTTCATATTGCCATAGGTTCCTTTTAGGAATCCACAAGTCTTGCCAAATCAGGTTATTATGCCTGTCTAAGTCTAGGAATGCATTCCAAATGTGCCTTACCGTGCCTTACCAAAACGGGTGACGAGAGTGACCTCCCTCCAAATTGGAAAGGGAAAGCTTCGTTGCCCAACAAACTCGTAGACTAAGTTCCATTTGCTGTTCCATTTGCTGTTTTTGCTGTAGTTAGTATACTAGCTCATTTGGCTTTACA

Full Affymetrix probeset data:

Annotations for 1625431_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime