Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625432_at:

>probe:Drosophila_2:1625432_at:464:247; Interrogation_Position=1414; Antisense; AATTCCGACATGTTGCTAGCGGGCG
>probe:Drosophila_2:1625432_at:368:613; Interrogation_Position=1448; Antisense; TGAAGCCACAACAGCCACGCAAGTT
>probe:Drosophila_2:1625432_at:405:521; Interrogation_Position=1505; Antisense; GTGGCAGCACACTAGCAACATTGGT
>probe:Drosophila_2:1625432_at:647:111; Interrogation_Position=1586; Antisense; AGCAACATGTTGCACCGTCACTCTT
>probe:Drosophila_2:1625432_at:190:187; Interrogation_Position=1642; Antisense; AACAACACACTAACGGAGGCTTCTC
>probe:Drosophila_2:1625432_at:295:35; Interrogation_Position=1690; Antisense; ATCACGTCCGCAACAACCATGAAGA
>probe:Drosophila_2:1625432_at:324:423; Interrogation_Position=1713; Antisense; GAGACCCATACGGAAGTTCACCAAG
>probe:Drosophila_2:1625432_at:622:119; Interrogation_Position=1763; Antisense; AGCTGACCTATGTGCGCAATGCGGG
>probe:Drosophila_2:1625432_at:702:249; Interrogation_Position=1779; Antisense; CAATGCGGGCGGAGATATCGACATC
>probe:Drosophila_2:1625432_at:730:43; Interrogation_Position=1795; Antisense; ATCGACATCGATAACCTGGACAACA
>probe:Drosophila_2:1625432_at:221:559; Interrogation_Position=1812; Antisense; GGACAACATCAGTGTGTATCCCGTT
>probe:Drosophila_2:1625432_at:449:481; Interrogation_Position=1827; Antisense; GTATCCCGTTCTCTACGATGGTGAT
>probe:Drosophila_2:1625432_at:652:463; Interrogation_Position=1938; Antisense; GATTCGCATCGGCATGAACAGGATA
>probe:Drosophila_2:1625432_at:708:211; Interrogation_Position=1972; Antisense; AAGACACTGCATTGGTTCACTCATC

Paste this into a BLAST search page for me
AATTCCGACATGTTGCTAGCGGGCGTGAAGCCACAACAGCCACGCAAGTTGTGGCAGCACACTAGCAACATTGGTAGCAACATGTTGCACCGTCACTCTTAACAACACACTAACGGAGGCTTCTCATCACGTCCGCAACAACCATGAAGAGAGACCCATACGGAAGTTCACCAAGAGCTGACCTATGTGCGCAATGCGGGCAATGCGGGCGGAGATATCGACATCATCGACATCGATAACCTGGACAACAGGACAACATCAGTGTGTATCCCGTTGTATCCCGTTCTCTACGATGGTGATGATTCGCATCGGCATGAACAGGATAAAGACACTGCATTGGTTCACTCATC

Full Affymetrix probeset data:

Annotations for 1625432_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime