FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625433_at:

>probe:Drosophila_2:1625433_at:384:207; Interrogation_Position=390; Antisense; AAGCTTCTTGACATAGACAGCGATG
>probe:Drosophila_2:1625433_at:262:483; Interrogation_Position=448; Antisense; GTATAACTAGAGTAGCCATCGACGA
>probe:Drosophila_2:1625433_at:515:313; Interrogation_Position=462; Antisense; GCCATCGACGATATTACTCCAATTG
>probe:Drosophila_2:1625433_at:71:389; Interrogation_Position=524; Antisense; GAAACGTGGCGGTCTTTCCCTAGAT
>probe:Drosophila_2:1625433_at:9:537; Interrogation_Position=534; Antisense; GGTCTTTCCCTAGATCGCTATAAGG
>probe:Drosophila_2:1625433_at:143:491; Interrogation_Position=568; Antisense; GTCAATTTTTGGGAAACACAGCCGA
>probe:Drosophila_2:1625433_at:120:159; Interrogation_Position=583; Antisense; ACACAGCCGATAATCATCCAGCAGT
>probe:Drosophila_2:1625433_at:196:103; Interrogation_Position=602; Antisense; AGCAGTAAATCTCTTTGGGCCCTTA
>probe:Drosophila_2:1625433_at:37:655; Interrogation_Position=644; Antisense; TAATTGTCTTCGCTGTTGTTCAACA
>probe:Drosophila_2:1625433_at:252:495; Interrogation_Position=758; Antisense; GTCAGATGAGTTCGTCAGTTCGTTA
>probe:Drosophila_2:1625433_at:315:25; Interrogation_Position=799; Antisense; ATACGTTAAGTACAATTGCTCTCAG
>probe:Drosophila_2:1625433_at:106:323; Interrogation_Position=845; Antisense; GTTGGCGTTCTCTCTTAAAAGGGCT
>probe:Drosophila_2:1625433_at:700:79; Interrogation_Position=864; Antisense; AGGGCTCTTCTGTTAAAACCTCTCT
>probe:Drosophila_2:1625433_at:468:175; Interrogation_Position=879; Antisense; AAACCTCTCTCTCAATACAGAGTTG

Paste this into a BLAST search page for me
AAGCTTCTTGACATAGACAGCGATGGTATAACTAGAGTAGCCATCGACGAGCCATCGACGATATTACTCCAATTGGAAACGTGGCGGTCTTTCCCTAGATGGTCTTTCCCTAGATCGCTATAAGGGTCAATTTTTGGGAAACACAGCCGAACACAGCCGATAATCATCCAGCAGTAGCAGTAAATCTCTTTGGGCCCTTATAATTGTCTTCGCTGTTGTTCAACAGTCAGATGAGTTCGTCAGTTCGTTAATACGTTAAGTACAATTGCTCTCAGGTTGGCGTTCTCTCTTAAAAGGGCTAGGGCTCTTCTGTTAAAACCTCTCTAAACCTCTCTCTCAATACAGAGTTG

Full Affymetrix probeset data:

Annotations for 1625433_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720