FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625434_at:

>probe:Drosophila_2:1625434_at:630:693; Interrogation_Position=1021; Antisense; TTTGAAACGGATGTCTGGCCCACAC
>probe:Drosophila_2:1625434_at:717:199; Interrogation_Position=1051; Antisense; AACCGAGTTCCTGCTTTTGAGTCTG
>probe:Drosophila_2:1625434_at:149:595; Interrogation_Position=1093; Antisense; TGGGCGGGCTTCTATGACCACAACA
>probe:Drosophila_2:1625434_at:364:667; Interrogation_Position=1156; Antisense; TACAGCAATCTCTTCATTGCCGCAG
>probe:Drosophila_2:1625434_at:416:341; Interrogation_Position=1181; Antisense; GCTTCAGTGGGCACGGCATTCAGCA
>probe:Drosophila_2:1625434_at:24:519; Interrogation_Position=1216; Antisense; GTGGGTCGAGCCATTTCCGAACTAA
>probe:Drosophila_2:1625434_at:367:557; Interrogation_Position=1245; Antisense; GGACGGCAAGTTTACCACACTGGAT
>probe:Drosophila_2:1625434_at:40:381; Interrogation_Position=1288; Antisense; GAACGCCTTGTAAACCAACAGCCTA
>probe:Drosophila_2:1625434_at:512:153; Interrogation_Position=1346; Antisense; ACAGGAGGATCGTACTTGCCCTTGG
>probe:Drosophila_2:1625434_at:335:275; Interrogation_Position=1360; Antisense; CTTGCCCTTGGTGTGTTTATGTATG
>probe:Drosophila_2:1625434_at:212:493; Interrogation_Position=866; Antisense; GTAAGAATTGTCCTGGGCTAGCCAC
>probe:Drosophila_2:1625434_at:311:441; Interrogation_Position=910; Antisense; GATGGCACCTACTTCAGGCGGGACG
>probe:Drosophila_2:1625434_at:483:597; Interrogation_Position=953; Antisense; TGTGCGGCCGCAGTCCAAACGAAGA
>probe:Drosophila_2:1625434_at:726:507; Interrogation_Position=990; Antisense; GTGCGAAACGCTGGACGTGGACCAC

Paste this into a BLAST search page for me
TTTGAAACGGATGTCTGGCCCACACAACCGAGTTCCTGCTTTTGAGTCTGTGGGCGGGCTTCTATGACCACAACATACAGCAATCTCTTCATTGCCGCAGGCTTCAGTGGGCACGGCATTCAGCAGTGGGTCGAGCCATTTCCGAACTAAGGACGGCAAGTTTACCACACTGGATGAACGCCTTGTAAACCAACAGCCTAACAGGAGGATCGTACTTGCCCTTGGCTTGCCCTTGGTGTGTTTATGTATGGTAAGAATTGTCCTGGGCTAGCCACGATGGCACCTACTTCAGGCGGGACGTGTGCGGCCGCAGTCCAAACGAAGAGTGCGAAACGCTGGACGTGGACCAC

Full Affymetrix probeset data:

Annotations for 1625434_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720