FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625435_at:

>probe:Drosophila_2:1625435_at:450:269; Interrogation_Position=553; Antisense; GTAAAATCCGGTGAGTCCCACTGGC
>probe:Drosophila_2:1625435_at:685:21; Interrogation_Position=582; Antisense; ATATCATTTGGCCAGGAGCCCGCCA
>probe:Drosophila_2:1625435_at:492:119; Interrogation_Position=628; Antisense; AGCGGAACTGGCCTCCCAGTTATCG
>probe:Drosophila_2:1625435_at:191:93; Interrogation_Position=645; Antisense; AGTTATCGCTGCCTTGCGCTGTTTG
>probe:Drosophila_2:1625435_at:671:323; Interrogation_Position=660; Antisense; GCGCTGTTTGCAATCTTTCGGTTAT
>probe:Drosophila_2:1625435_at:207:539; Interrogation_Position=679; Antisense; GGTTATGTAACCTTCTAGTGGGCTT
>probe:Drosophila_2:1625435_at:502:657; Interrogation_Position=686; Antisense; TAACCTTCTAGTGGGCTTGCTTATG
>probe:Drosophila_2:1625435_at:69:519; Interrogation_Position=696; Antisense; GTGGGCTTGCTTATGAAAACAGAAT
>probe:Drosophila_2:1625435_at:138:55; Interrogation_Position=719; Antisense; ATGAAAACGAGAACACCGGGTTGTG
>probe:Drosophila_2:1625435_at:406:523; Interrogation_Position=744; Antisense; GGGCCATGCAAATGTAAGCCCATGT
>probe:Drosophila_2:1625435_at:576:167; Interrogation_Position=753; Antisense; AAATGTAAGCCCATGTGTGCCCGCA
>probe:Drosophila_2:1625435_at:79:597; Interrogation_Position=768; Antisense; TGTGCCCGCAATCCAAACTACTTTG
>probe:Drosophila_2:1625435_at:61:257; Interrogation_Position=781; Antisense; CAAACTACTTTGGAGCACATATGCA
>probe:Drosophila_2:1625435_at:32:553; Interrogation_Position=792; Antisense; GGAGCACATATGCATGTACATACGT

Paste this into a BLAST search page for me
GTAAAATCCGGTGAGTCCCACTGGCATATCATTTGGCCAGGAGCCCGCCAAGCGGAACTGGCCTCCCAGTTATCGAGTTATCGCTGCCTTGCGCTGTTTGGCGCTGTTTGCAATCTTTCGGTTATGGTTATGTAACCTTCTAGTGGGCTTTAACCTTCTAGTGGGCTTGCTTATGGTGGGCTTGCTTATGAAAACAGAATATGAAAACGAGAACACCGGGTTGTGGGGCCATGCAAATGTAAGCCCATGTAAATGTAAGCCCATGTGTGCCCGCATGTGCCCGCAATCCAAACTACTTTGCAAACTACTTTGGAGCACATATGCAGGAGCACATATGCATGTACATACGT

Full Affymetrix probeset data:

Annotations for 1625435_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720