FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625436_at:

>probe:Drosophila_2:1625436_at:622:615; Interrogation_Position=1005; Antisense; TGCACCCGGCGACAACAATGAAGTT
>probe:Drosophila_2:1625436_at:487:91; Interrogation_Position=1026; Antisense; AGTTTTCATCCCAGTGGACAAGCCA
>probe:Drosophila_2:1625436_at:569:37; Interrogation_Position=1060; Antisense; ATCTATGCCCAATTGGCCCGGAAGA
>probe:Drosophila_2:1625436_at:262:243; Interrogation_Position=1090; Antisense; AATAGTCACCTGTAGATCGATCTCT
>probe:Drosophila_2:1625436_at:108:367; Interrogation_Position=1209; Antisense; GAATCATATGCTGCGTTCTTCTTAT
>probe:Drosophila_2:1625436_at:317:383; Interrogation_Position=699; Antisense; GAACGATGAGTTCAGATCTCTGCCA
>probe:Drosophila_2:1625436_at:69:59; Interrogation_Position=731; Antisense; ATGATCGCATCTTTAGCACCGTGGT
>probe:Drosophila_2:1625436_at:231:465; Interrogation_Position=757; Antisense; GATTGCTCCTGGGAGTACTCCGATA
>probe:Drosophila_2:1625436_at:355:457; Interrogation_Position=778; Antisense; GATACCGAGAACTTGGACTTCCTCA
>probe:Drosophila_2:1625436_at:149:649; Interrogation_Position=800; Antisense; TCAGGGCCTGGCAAACGGTCAAAAA
>probe:Drosophila_2:1625436_at:618:7; Interrogation_Position=832; Antisense; ATTCGTAACTTTGCTGGCGATCCGC
>probe:Drosophila_2:1625436_at:127:265; Interrogation_Position=883; Antisense; CAGCACACCCTGTATCTGAGTGAAA
>probe:Drosophila_2:1625436_at:167:173; Interrogation_Position=905; Antisense; AAAGACAGGTCCTGGATGTCCTGCC
>probe:Drosophila_2:1625436_at:655:295; Interrogation_Position=929; Antisense; CGCAGGTGTCGGTCATTTCGATGAC

Paste this into a BLAST search page for me
TGCACCCGGCGACAACAATGAAGTTAGTTTTCATCCCAGTGGACAAGCCAATCTATGCCCAATTGGCCCGGAAGAAATAGTCACCTGTAGATCGATCTCTGAATCATATGCTGCGTTCTTCTTATGAACGATGAGTTCAGATCTCTGCCAATGATCGCATCTTTAGCACCGTGGTGATTGCTCCTGGGAGTACTCCGATAGATACCGAGAACTTGGACTTCCTCATCAGGGCCTGGCAAACGGTCAAAAAATTCGTAACTTTGCTGGCGATCCGCCAGCACACCCTGTATCTGAGTGAAAAAAGACAGGTCCTGGATGTCCTGCCCGCAGGTGTCGGTCATTTCGATGAC

Full Affymetrix probeset data:

Annotations for 1625436_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720