FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625437_at:

>probe:Drosophila_2:1625437_at:702:509; Interrogation_Position=3363; Antisense; GTGCAAGCCCTGTAAGCCCACATAT
>probe:Drosophila_2:1625437_at:236:493; Interrogation_Position=3374; Antisense; GTAAGCCCACATATCCGTGTGAAAA
>probe:Drosophila_2:1625437_at:75:685; Interrogation_Position=3385; Antisense; TATCCGTGTGAAAACCACCAAACAG
>probe:Drosophila_2:1625437_at:453:303; Interrogation_Position=3430; Antisense; CCGCCCGCAGATTCATTTATTGGAA
>probe:Drosophila_2:1625437_at:505:513; Interrogation_Position=3455; Antisense; GTGATGCAAGCTTTTTATACGAATA
>probe:Drosophila_2:1625437_at:164:679; Interrogation_Position=3489; Antisense; TAGTCTTAAATTTCAGTTGTGCTTC
>probe:Drosophila_2:1625437_at:681:17; Interrogation_Position=3498; Antisense; ATTTCAGTTGTGCTTCTGTGGAGTT
>probe:Drosophila_2:1625437_at:81:343; Interrogation_Position=3509; Antisense; GCTTCTGTGGAGTTAAATCATTCAA
>probe:Drosophila_2:1625437_at:397:85; Interrogation_Position=3533; Antisense; AGATGAGCGATCTTTAAAAGGGCAA
>probe:Drosophila_2:1625437_at:551:359; Interrogation_Position=3554; Antisense; GCAAGATGAAGGTTTCTACGCGCCA
>probe:Drosophila_2:1625437_at:194:443; Interrogation_Position=3558; Antisense; GATGAAGGTTTCTACGCGCCAAAAA
>probe:Drosophila_2:1625437_at:384:699; Interrogation_Position=3598; Antisense; TTCTAACTTATAACCACATCCAGTG
>probe:Drosophila_2:1625437_at:230:151; Interrogation_Position=3613; Antisense; ACATCCAGTGAGACATTAATATGCA
>probe:Drosophila_2:1625437_at:553:529; Interrogation_Position=3651; Antisense; GGGATTACTTGTTTCATTGAAGGCT

Paste this into a BLAST search page for me
GTGCAAGCCCTGTAAGCCCACATATGTAAGCCCACATATCCGTGTGAAAATATCCGTGTGAAAACCACCAAACAGCCGCCCGCAGATTCATTTATTGGAAGTGATGCAAGCTTTTTATACGAATATAGTCTTAAATTTCAGTTGTGCTTCATTTCAGTTGTGCTTCTGTGGAGTTGCTTCTGTGGAGTTAAATCATTCAAAGATGAGCGATCTTTAAAAGGGCAAGCAAGATGAAGGTTTCTACGCGCCAGATGAAGGTTTCTACGCGCCAAAAATTCTAACTTATAACCACATCCAGTGACATCCAGTGAGACATTAATATGCAGGGATTACTTGTTTCATTGAAGGCT

Full Affymetrix probeset data:

Annotations for 1625437_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720