FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625438_at:

>probe:Drosophila_2:1625438_at:45:193; Interrogation_Position=117; Antisense; AACTAAACATGCAGTCCTCCAGCAT
>probe:Drosophila_2:1625438_at:5:15; Interrogation_Position=182; Antisense; ATTAGGGCTGCTCCTCTGGACGACT
>probe:Drosophila_2:1625438_at:577:633; Interrogation_Position=206; Antisense; TCCCAACATGCCACCATACTAAGAT
>probe:Drosophila_2:1625438_at:679:395; Interrogation_Position=239; Antisense; GACAACATTGGCACTGATGGCTACA
>probe:Drosophila_2:1625438_at:128:441; Interrogation_Position=254; Antisense; GATGGCTACAACTTCGGCTACGAGA
>probe:Drosophila_2:1625438_at:724:101; Interrogation_Position=276; Antisense; AGACCAGTGATGGAGTTACCCGCCA
>probe:Drosophila_2:1625438_at:522:363; Interrogation_Position=288; Antisense; GAGTTACCCGCCAGGAGCAGGCTGA
>probe:Drosophila_2:1625438_at:656:609; Interrogation_Position=315; Antisense; TGAAGAACGCCGGTACCGACCAGGA
>probe:Drosophila_2:1625438_at:294:649; Interrogation_Position=345; Antisense; TCAGTGTGCGCGGTTCCGTCAGCTG
>probe:Drosophila_2:1625438_at:366:155; Interrogation_Position=393; Antisense; ACACCCTGCACTACATTGCGGATGA
>probe:Drosophila_2:1625438_at:591:39; Interrogation_Position=444; Antisense; ATCTGCCCCACAACTAAGTATTTCC
>probe:Drosophila_2:1625438_at:106:483; Interrogation_Position=461; Antisense; GTATTTCCTCTTTGTGTAGTCAGTA
>probe:Drosophila_2:1625438_at:532:33; Interrogation_Position=629; Antisense; ATCACAATCAAATGCCAGTCTTCAG
>probe:Drosophila_2:1625438_at:68:217; Interrogation_Position=94; Antisense; AAGTCTCTACCAGAATCCAATCCAA

Paste this into a BLAST search page for me
AACTAAACATGCAGTCCTCCAGCATATTAGGGCTGCTCCTCTGGACGACTTCCCAACATGCCACCATACTAAGATGACAACATTGGCACTGATGGCTACAGATGGCTACAACTTCGGCTACGAGAAGACCAGTGATGGAGTTACCCGCCAGAGTTACCCGCCAGGAGCAGGCTGATGAAGAACGCCGGTACCGACCAGGATCAGTGTGCGCGGTTCCGTCAGCTGACACCCTGCACTACATTGCGGATGAATCTGCCCCACAACTAAGTATTTCCGTATTTCCTCTTTGTGTAGTCAGTAATCACAATCAAATGCCAGTCTTCAGAAGTCTCTACCAGAATCCAATCCAA

Full Affymetrix probeset data:

Annotations for 1625438_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720