Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625443_a_at:

>probe:Drosophila_2:1625443_a_at:199:189; Interrogation_Position=144; Antisense; AACTACGTAGCGCATTTCGGCGAGC
>probe:Drosophila_2:1625443_a_at:352:715; Interrogation_Position=159; Antisense; TTCGGCGAGCTTTTGTAGTCGGAAT
>probe:Drosophila_2:1625443_a_at:525:499; Interrogation_Position=176; Antisense; GTCGGAATGTCATCCAAACCTCAGT
>probe:Drosophila_2:1625443_a_at:332:175; Interrogation_Position=191; Antisense; AAACCTCAGTACACCCTAAGCGAAG
>probe:Drosophila_2:1625443_a_at:472:211; Interrogation_Position=242; Antisense; AAGACCTATTCCTTGGCGCACTGTG
>probe:Drosophila_2:1625443_a_at:580:265; Interrogation_Position=273; Antisense; CAGATCTTGCGATGGGTGCTGGAAT
>probe:Drosophila_2:1625443_a_at:561:533; Interrogation_Position=287; Antisense; GGTGCTGGAATTGCCGTGCAGTTCA
>probe:Drosophila_2:1625443_a_at:488:223; Interrogation_Position=325; Antisense; AAGGTTGGACGAGCTGCAAGCCCAA
>probe:Drosophila_2:1625443_a_at:297:145; Interrogation_Position=402; Antisense; ACTACCTAGTAACCAAGCCTCAGAG
>probe:Drosophila_2:1625443_a_at:635:205; Interrogation_Position=434; Antisense; AAGCCCACCTACGAATCTGTACAAG
>probe:Drosophila_2:1625443_a_at:568:365; Interrogation_Position=446; Antisense; GAATCTGTACAAGCATCTTTGGAGC
>probe:Drosophila_2:1625443_a_at:123:197; Interrogation_Position=497; Antisense; AACGTGAATAAGCTGGCCATCCCAA
>probe:Drosophila_2:1625443_a_at:117:163; Interrogation_Position=522; Antisense; AAATTGGCTGCGGAATTGATGGCTT
>probe:Drosophila_2:1625443_a_at:249:417; Interrogation_Position=552; Antisense; GGGAAAAAGTCAGCGGAGTCCTCGA

Paste this into a BLAST search page for me
AACTACGTAGCGCATTTCGGCGAGCTTCGGCGAGCTTTTGTAGTCGGAATGTCGGAATGTCATCCAAACCTCAGTAAACCTCAGTACACCCTAAGCGAAGAAGACCTATTCCTTGGCGCACTGTGCAGATCTTGCGATGGGTGCTGGAATGGTGCTGGAATTGCCGTGCAGTTCAAAGGTTGGACGAGCTGCAAGCCCAAACTACCTAGTAACCAAGCCTCAGAGAAGCCCACCTACGAATCTGTACAAGGAATCTGTACAAGCATCTTTGGAGCAACGTGAATAAGCTGGCCATCCCAAAAATTGGCTGCGGAATTGATGGCTTGGGAAAAAGTCAGCGGAGTCCTCGA

Full Affymetrix probeset data:

Annotations for 1625443_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime