FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625444_at:

>probe:Drosophila_2:1625444_at:475:673; Interrogation_Position=220; Antisense; TACCAAGGTGGGATTCTATGACTCG
>probe:Drosophila_2:1625444_at:670:407; Interrogation_Position=251; Antisense; GACGGGATCGTCCTCGGAATCAAGA
>probe:Drosophila_2:1625444_at:145:379; Interrogation_Position=274; Antisense; GAACATCAAGGTGCTCGGTCAAACG
>probe:Drosophila_2:1625444_at:304:177; Interrogation_Position=294; Antisense; AAACGGCGGGTCTACGCGCAGACGA
>probe:Drosophila_2:1625444_at:25:451; Interrogation_Position=317; Antisense; GATCCCACCATGCATCTGGTCATAA
>probe:Drosophila_2:1625444_at:241:555; Interrogation_Position=346; Antisense; GGACTTTTATGTCTTCCGACCGAAG
>probe:Drosophila_2:1625444_at:535:11; Interrogation_Position=380; Antisense; ATTCTGAGCGGCGTGGTGCGACACA
>probe:Drosophila_2:1625444_at:494:61; Interrogation_Position=417; Antisense; ATGTCAGCGCCGTCATTTACCGGGT
>probe:Drosophila_2:1625444_at:354:495; Interrogation_Position=428; Antisense; GTCATTTACCGGGTCTTCAACACCT
>probe:Drosophila_2:1625444_at:463:651; Interrogation_Position=444; Antisense; TCAACACCTCCATACGTTTCACAAA
>probe:Drosophila_2:1625444_at:399:203; Interrogation_Position=467; Antisense; AACCAGAGTGCAAGTCGCGAGGACA
>probe:Drosophila_2:1625444_at:81:459; Interrogation_Position=533; Antisense; GATATCAGCAACTTGATGCCTTACA
>probe:Drosophila_2:1625444_at:569:445; Interrogation_Position=547; Antisense; GATGCCTTACATCGAGGGAGAACTA
>probe:Drosophila_2:1625444_at:460:393; Interrogation_Position=697; Antisense; GAAAGAACCTGAATTCACGCCGAGA

Paste this into a BLAST search page for me
TACCAAGGTGGGATTCTATGACTCGGACGGGATCGTCCTCGGAATCAAGAGAACATCAAGGTGCTCGGTCAAACGAAACGGCGGGTCTACGCGCAGACGAGATCCCACCATGCATCTGGTCATAAGGACTTTTATGTCTTCCGACCGAAGATTCTGAGCGGCGTGGTGCGACACAATGTCAGCGCCGTCATTTACCGGGTGTCATTTACCGGGTCTTCAACACCTTCAACACCTCCATACGTTTCACAAAAACCAGAGTGCAAGTCGCGAGGACAGATATCAGCAACTTGATGCCTTACAGATGCCTTACATCGAGGGAGAACTAGAAAGAACCTGAATTCACGCCGAGA

Full Affymetrix probeset data:

Annotations for 1625444_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720