Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625446_at:

>probe:Drosophila_2:1625446_at:255:667; Interrogation_Position=2827; Antisense; TACTTGTATGTCATCGTTACTTCGT
>probe:Drosophila_2:1625446_at:141:497; Interrogation_Position=2836; Antisense; GTCATCGTTACTTCGTTTACCATCA
>probe:Drosophila_2:1625446_at:327:481; Interrogation_Position=2892; Antisense; GTATTCGTTATGCAATGAACTCAGT
>probe:Drosophila_2:1625446_at:706:279; Interrogation_Position=2911; Antisense; CTCAGTATCGAGTGAATGTCAGTGT
>probe:Drosophila_2:1625446_at:330:65; Interrogation_Position=2949; Antisense; ATGGTGAATGTGTGTTCGCTTGTGT
>probe:Drosophila_2:1625446_at:677:231; Interrogation_Position=3011; Antisense; AATGAATCGCGCTTGAATTTTGTAT
>probe:Drosophila_2:1625446_at:692:475; Interrogation_Position=3054; Antisense; GTTATCGTTTCTTAAATGCGACAAT
>probe:Drosophila_2:1625446_at:254:473; Interrogation_Position=3118; Antisense; GTTCTTGTTTCTTGTTGCTGAGCAT
>probe:Drosophila_2:1625446_at:185:723; Interrogation_Position=3132; Antisense; TTGCTGAGCATTTGCGTTCGCACAT
>probe:Drosophila_2:1625446_at:353:11; Interrogation_Position=3185; Antisense; ATTCATTCGCATTCGTCGAATCGCG
>probe:Drosophila_2:1625446_at:97:45; Interrogation_Position=3204; Antisense; ATCGCGAAATCGTTTTATCCACTTT
>probe:Drosophila_2:1625446_at:221:683; Interrogation_Position=3242; Antisense; TTGTTACTTTACTTGATTTCTGGTT
>probe:Drosophila_2:1625446_at:216:19; Interrogation_Position=3257; Antisense; ATTTCTGGTTTAGTTGATGCGGTTA
>probe:Drosophila_2:1625446_at:538:491; Interrogation_Position=3305; Antisense; GTAAATTTTGCTTTTTGCCTTTGCT

Paste this into a BLAST search page for me
TACTTGTATGTCATCGTTACTTCGTGTCATCGTTACTTCGTTTACCATCAGTATTCGTTATGCAATGAACTCAGTCTCAGTATCGAGTGAATGTCAGTGTATGGTGAATGTGTGTTCGCTTGTGTAATGAATCGCGCTTGAATTTTGTATGTTATCGTTTCTTAAATGCGACAATGTTCTTGTTTCTTGTTGCTGAGCATTTGCTGAGCATTTGCGTTCGCACATATTCATTCGCATTCGTCGAATCGCGATCGCGAAATCGTTTTATCCACTTTTTGTTACTTTACTTGATTTCTGGTTATTTCTGGTTTAGTTGATGCGGTTAGTAAATTTTGCTTTTTGCCTTTGCT

Full Affymetrix probeset data:

Annotations for 1625446_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime