FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625447_at:

>probe:Drosophila_2:1625447_at:235:545; Interrogation_Position=3723; Antisense; GGATCGCCAGATTGAGACGCTAGTG
>probe:Drosophila_2:1625447_at:475:587; Interrogation_Position=3782; Antisense; TGGAGCGTCAATGGCGCGACATCGC
>probe:Drosophila_2:1625447_at:42:681; Interrogation_Position=3864; Antisense; TATGCAGCACTACAGGGACAAGGTC
>probe:Drosophila_2:1625447_at:254:505; Interrogation_Position=3886; Antisense; GTCCAGGTGGACGAGGTTTATCAGT
>probe:Drosophila_2:1625447_at:430:35; Interrogation_Position=3905; Antisense; ATCAGTCCTTCAAGCTCATCATTAG
>probe:Drosophila_2:1625447_at:407:171; Interrogation_Position=3961; Antisense; AAAGCTGTAGTCACCGAGTTCGAGA
>probe:Drosophila_2:1625447_at:323:381; Interrogation_Position=3984; Antisense; GAACCGACTGAACGAGTGCCTGCAA
>probe:Drosophila_2:1625447_at:656:431; Interrogation_Position=3997; Antisense; GAGTGCCTGCAAGTCAACCCGGATA
>probe:Drosophila_2:1625447_at:268:673; Interrogation_Position=4020; Antisense; TACCGCTGCCCAGGGTGATCAAGAA
>probe:Drosophila_2:1625447_at:459:173; Interrogation_Position=4043; Antisense; AAAGCACTCCAGAAGGTCAGGGCAA
>probe:Drosophila_2:1625447_at:69:359; Interrogation_Position=4064; Antisense; GCAACAGAACCAGAGCGGCGCCAAG
>probe:Drosophila_2:1625447_at:265:529; Interrogation_Position=4163; Antisense; GGGATTCCACCTCAGAAGAGAGCTT
>probe:Drosophila_2:1625447_at:19:677; Interrogation_Position=4207; Antisense; TAGTTCGTGCTCCATCTTAAGTTAC
>probe:Drosophila_2:1625447_at:250:467; Interrogation_Position=4227; Antisense; GTTACGATCTGAGCGGGTTTTTAAT

Paste this into a BLAST search page for me
GGATCGCCAGATTGAGACGCTAGTGTGGAGCGTCAATGGCGCGACATCGCTATGCAGCACTACAGGGACAAGGTCGTCCAGGTGGACGAGGTTTATCAGTATCAGTCCTTCAAGCTCATCATTAGAAAGCTGTAGTCACCGAGTTCGAGAGAACCGACTGAACGAGTGCCTGCAAGAGTGCCTGCAAGTCAACCCGGATATACCGCTGCCCAGGGTGATCAAGAAAAAGCACTCCAGAAGGTCAGGGCAAGCAACAGAACCAGAGCGGCGCCAAGGGGATTCCACCTCAGAAGAGAGCTTTAGTTCGTGCTCCATCTTAAGTTACGTTACGATCTGAGCGGGTTTTTAAT

Full Affymetrix probeset data:

Annotations for 1625447_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720